BEAST XML Reference

BEAST elements

The following is a list of valid elements in a beast file.

<advancedTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

Attribute (optional) useAmbiguities is Boolean
Attribute (optional) storePartials is Boolean
Attribute (optional) useScaling is Boolean

The element has the following contents:

Element named <tips> containing:
- SiteModel element (exactly one)
  A siteModel that will be applied only to the tips.
Element named <delta> containing:
- Parameter element (exactly one)
  A parameter that specifies the amount of extra substitutions per site at each tip.
Element named <clade> containing:
- Attribute (optional) includeStem is Boolean
  determines whether or not the stem branch above this clade is included in the siteModel.
- Taxa element (exactly one)
  A set of taxa which defines a clade to apply a different site model to
- SiteModel element (exactly one)
  A siteModel that will be applied only to this clade
PatternList element (exactly one)
TreeModel element (exactly one)
SiteModel element (exactly one)
BranchRateModel element (zero or one)

Example:

<alignment> element

This element represents an alignment of molecular sequences.

The element has the following contents:

One of:
- Attribute dataType is String
  The data type
- DataType element (exactly one)

Sequence elements (one or more)

Example:

<alignment missing="-?" dataType="nucleotide">
<sequence>
<taxon idref="taxon1"/>
ACGACTAGCATCGAGCTTCG--GATAGCAGGC
</sequence>
<sequence>
<taxon idref="taxon2"/>
ACGACTAGCATCGAGCTTCGG-GATAGCATGC
</sequence>
<sequence>
<taxon idref="taxon3"/>
ACG?CTAGAATCGAGCTTCGAGGATAGCATGC
</sequence>
</alignment>

<alignmentChunkOperator> element

This element represents an operator that re-aligns a small chunk of an alignment.

The element takes following attributes:

Attribute weight is Integer
Attribute iP is Double
tuning probability, values near zero resamples entire alignment and near 1.0 resamples single columns.
Attribute exponent is Double
tuning parameter, value of 1.0 samples random alignments, large values (e.g. 2.7) sample alignment peaked around 'best' alignment
Attribute gapPenalty is Double
tuning parameter, must be negative, large values penalize gaps more in the alignment proposal.

The element has the following contents:

TKF91Likelihood element (exactly one)

Example:

<aminoAcidModel> element

An empirical amino acid substitution model.

The element takes following attributes:

Attribute type is String
The type of empirical amino-acid rate matrix

The element has the following contents:

Element named <frequencies> containing:
- FrequencyModel element (exactly one)
  If the frequencies are omitted than the empirical frequencies associated with the selected model are used.

Example:

<array> element

This element returns an array of the objects it contains.

The element has the following contents:

Object elements (one or more)
Objects to be put in an array

Example:

<attr> element

This element represents a name/value pair.

The element takes following attributes:

Attribute name is String
The name to give to this attribute

The element has the following contents:

Object element (exactly one)

Example:

<attributes> element

This element represents an array of name/value pairs.

The element takes following attributes:

Attribute names is String;
Attribute values is String;

Example:

<betaSplittingModel> element

The beta-splitting family of tree branching models (Aldous, 1996;2001).

The element has the following contents:

Element named <phi> containing:
- Parameter element (exactly one)
  A parameter that ranges from -infinity (comb-tree) to +infinity (balanced tree)
Element named <branchingTree> containing:
- Tree element (exactly one)

Example:

<binomialLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.

The element has the following contents:

Element named <trials> containing:
- Parameter element (exactly one)
Element named <proportion> containing:
- Parameter element (exactly one)
Element named <counts> containing:
- Attribute values is Integer;

Example:

<birthDeathModel> element

The Yang & Rannala (1997) model of speciation.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <birthRate> containing:
- Parameter element (exactly one)
Element named <deathRate> containing:
- Parameter element (exactly one)
Element named <samplingProportion> containing:
- Parameter element (exactly one)

Example:

<bitFlipOperator> element

This element returns a bit-flip operator on a given parameter.

The element takes following attributes:

Attribute weight is Integer

The element has the following contents:

Parameter element (exactly one)

Example:

<bitSwapOperator> element

This element returns a bit-swap operator on a given parameter and data.

The element takes following attributes:

Attribute weight is Integer

The element has the following contents:

Element named <data> containing:
- Statistic element (exactly one)
Element named <indicators> containing:
- Statistic element (exactly one)

Example:

<booleanLikelihood> element

A function that log likelihood of a set of boolean statistics. If all the statistics are true then it returns 0.0 otherwise -infinity.

The element has the following contents:

BooleanStatistic elements (one or more)

Example:

<branchingLikelihood> element

This element represents the likelihood of the tree given the demographic function.

The element has the following contents:

Element named <model> containing:
- BranchingModel element (exactly one)
Element named <branchingTree> containing:
- TreeModel element (exactly one)

Example:

<cataclysm> element

A demographic model of exponential growth.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)
Element named <growthRate> containing:
- Parameter element (exactly one)
  The rate of exponential growth before the cataclysmic event.
Element named <spikeFactor> containing:
- Parameter element (exactly one)
  The factor larger the population size was at its height.
Element named <timeOfCataclysm> containing:
- Parameter element (exactly one)
  The time of the cataclysmic event that lead to exponential decline.

Example:

<centeredScale> element

A centered-scale operator. This operator scales the the values of a multi-dimensional parameter so as to perserve the mean. It does this by expanding or conrtacting the parameter values around the mean.

The element takes following attributes:

Attribute weight is Integer
Attribute scaleFactor is Double
Attribute (optional) autoOptimize is Boolean

The element has the following contents:

Parameter element (exactly one)

Example:

<coalescentLikelihood> element

This element represents the likelihood of the tree given the demographic function.

The element has the following contents:

Element named <model> containing:
- DemographicModel element (exactly one)
Element named <populationTree> containing:
- TreeModel element (exactly one)

Example:

<coalescentMRCALikelihood> element

A coalescent likelihood function for a subtree.

The element has the following contents:

Element named <model> containing:
- DemographicModel element (exactly one)
Element named <populationTree> containing:
- TreeModel element (exactly one)
Element named <mrca> containing:
- Taxa element (exactly one)
Element named <exclude> containing:
- Taxa elements (one or more)

Example:

<coalescentTree> element

This element returns a simulated tree under the given demographic model.

The element takes following attributes:

Attribute (optional) rescaleHeight is Double
Attempt to rescale the tree to the given root height

The element has the following contents:

One of:
- ConstantPopulationModel element (exactly one)
- ExponentialGrowthModel element (exactly one)

Example:

<colouredNarrowExchange> element

This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.

The element takes following attributes:

Attribute weight is Integer

The element has the following contents:

TreeModel element (exactly one)
ColourSamplerModel element (exactly one)

Example:

<colouredNarrowExchange weight="1">
<treeModel idref="treeModel4"/>
ERROR!
</colouredNarrowExchange>

<colouredOperator> element

This element represents an arbitrary operator immediately followed by a re-colouring of the tree

The element has the following contents:

MCMCOperator element (exactly one)
ColourSamplerModel element (exactly one)

Example:

<colouredOperator>
<rateExchange idref="rateExchange8"/>
ERROR!
</colouredOperator>

<colouredSubtreeSlide> element

An operator that slides a subtree.

The element takes following attributes:

Attribute weight is Integer
Attribute size is Double
Attribute gaussian is Boolean
Attribute (optional) swapRates is Boolean
Attribute (optional) swapTraits is Boolean
Attribute (optional) autoOptimize is Boolean

The element has the following contents:

TreeModel element (exactly one)
ColourSamplerModel element (exactly one)

Example:

<colouredSubtreeSlide weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
<treeModel idref="treeModel6"/>
ERROR!
</colouredSubtreeSlide>

<colouredWideExchange> element

This element represents a wide exchange operator. This operator swaps two random subtrees.

The element takes following attributes:

Attribute weight is Integer

The element has the following contents:

ColourSamplerModel element (exactly one)
TreeModel element (exactly one)

Example:

<colouredWideExchange weight="1">
ERROR!
<treeModel idref="treeModel8"/>
</colouredWideExchange>

<colourSamplerModel> element

This element represents a likelihood function for transmission.

The element has the following contents:

One of:
- Element named <colours> containing:
  - Taxa elements (one or more)
    Taxa for each subsequent colour (after 0).
- Alignment element (exactly one)
  The alignment.

TreeModel element (exactly one)
The tree.
MigrationModel element (exactly one)
The migration model.
MetaPopulationModel element (exactly one)
The metapopulation model,

Example:

<column> element

Specifies formating options for one or more columns in a log file.

The element takes following attributes:

Attribute (optional) label is String
The label of the column. If this is specified and more than one statistic is in this column, then the label will be appended by the index of the statistic to create individual column names
Attribute (optional) sf is Integer
Attribute (optional) dp is Integer
Attribute (optional) width is Integer

Example:

<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.

The element takes following attributes:

Attribute (optional) threads is Integer

The element has the following contents:

Likelihood elements (one or more)

Example:

<compoundParameter> element

A multidimensional parameter constructed from its component parameters.

The element has the following contents:

Parameter elements (one or more)

Example:

<constantExponential> element

A demographic model of constant population size followed by exponential growth.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)
Element named <growthPhaseStartTime> containing:
- Parameter element (exactly one)
One of:
- Element named <growthRate> containing:
  - Parameter element (exactly one)
    A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
- Element named <doublingTime> containing:
  - Parameter element (exactly one)
    This parameter determines the doubling time.

Example:

<constantLogistic> element

A demographic model of constant population size followed by logistic growth.

The element takes following attributes:

Attribute units is String
the units
Attribute alpha is Double

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)
Element named <ancestralPopulationSize> containing:
- Parameter element (exactly one)
Element named <growthRate> containing:
- Parameter element (exactly one)
Element named <shape> containing:
- Parameter element (exactly one)

Example:

<constantMigrationModel> element

A migration model representing constant migration rates through time.

The element has the following contents:

Element named <migrationRates> containing:
- Parameter element (exactly one)

Example:

<constantSize> element

A demographic model representing a constant population size through time.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)

Example:

<convert> element

Converts an alignment to the given data type.

The element takes following attributes:

Attribute dataType is String
The type of sequence data

The element has the following contents:

Alignment element (exactly one)

Example:

<covarionModel> element

A covarion substitution model of langauge evolution with binary data and a hidden rate state with two rates.

The element has the following contents:

Element named <frequencies> containing:
- FrequencyModel element (exactly one)
Element named <alpha> containing:
- Parameter element (zero or one)
Element named <beta> containing:
- Parameter element (zero or one)
Element named <gamma> containing:
- Parameter element (zero or one)

Example:

<date> element

Specifies a date on a given timescale

The element takes following attributes:

Attribute value is String
The value of this date
Attribute (optional) origin is String
The origin of this time scale, which must be a valid calendar date
Attribute (optional) units is String
The units of the timescale
Attribute (optional) direction is String
The direction of the timescale

Example:

<date value="10.0" units="years" direction="backwards"/>

<date value="300.0" origin="01/01/89" units="days" direction="forwards"/>

<deltaExchange> element

This element returns a scale operator on a given parameter.

The element takes following attributes:

Attribute delta is Double
Attribute (optional) parameterWeights is Integer;
Attribute weight is Integer
Attribute (optional) autoOptimize is Boolean
Attribute (optional) integer is Boolean

The element has the following contents:

Parameter element (exactly one)

Example:

<discretizedBranchRates> element

This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.

The element takes following attributes:

Attribute (optional) singleRootRate is Boolean
Whether only a single rate should be used for the two children branches of the root

The element has the following contents:

TreeModel element (exactly one)
Element named <distribution> containing:
- ParametricDistributionModel element (exactly one)
  The distribution model for rates among branches
Element named <rateCategories> containing:
- Parameter element (exactly one)
  The rate categories parameter

Example:

<distanceMatrix> element

Constructs a distance matrix from a pattern list or alignment

The element takes following attributes:

Attribute correction is String
The type of distance correction used

The element has the following contents:

PatternList element (exactly one)

Example:

<distributionLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.

The element has the following contents:

Element named <distribution> containing:
- ParametricDistributionModel element (exactly one)
Element named <data> containing:
- Statistic elements (one or more)

Example:

<double> element

returns a Double. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as a Double.

The element has the following contents:

One of:
- Attribute prompt is String
  A message displayed to the user when entering a value for this double
- Double element (exactly one)

Example:

<dummyLikelihood> element

A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.

The element has the following contents:

Model element (exactly one)
A model element

Example:

<EDLikelihood> element

This element returns an object that can calculate the likelihood of rate changes in a tree under the assumption of exponentially distributed rate changes among lineages. Specifically, each branch is assumed to draw a rate from an exponential distribution with mean of the rate in the parent branch.

The element takes following attributes:

Attribute (optional) rootModel is String
specify the rate model to use at the root. Should be one of: 'meanOfChildren', 'meanOfAll', 'equalToChild', 'ignoreRoot' or 'none'.

The element has the following contents:

TreeModel element (exactly one)
Element named <rates> containing:
- Parameter element (exactly one)
  The branch rates parameter

Example:

<empiricalDistributionLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.

The element has the following contents:

One of:
- Element named <logFile> containing:
  - Attribute fileName is String
    The file name of an BEAST log file
  - Attribute statistic is String
    The name of the column in the log file that will be used as an empirical distribution
  - Attribute burnIn is Integer
  - Attribute (optional) delta is Boolean
- Element named <histogram> containing:
  - X,Y data describing the distribution***:

Element named <data> containing:
- Statistic elements (one or more)

Example:

<empiricalPiecewise> element

This element represents a piecewise population model

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <intervalWidths> containing:
- Attribute values is Double;
Element named <populationSizes> containing:
- Parameter element (exactly one)
  The effective population sizes of each interval.
Element named <generationLength> containing:
- Parameter element (exactly one)
  The scale factor.
Element named <threshold> containing:
- Parameter element (exactly one)
  The threshold before counts occur.
Element named <lag> containing:
- Parameter element (exactly one)
  The lag between actual population sizes and genetic diversity.

Example:

<exp> element

This element returns a statistic that is the element-wise exponentiation of the child statistic.

The element has the following contents:

Statistic element (exactly one)

Example:

<expansion> element

A demographic model of constant population size followed by exponential growth.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)
Element named <ancestralPopulationProportion> containing:
- Parameter element (exactly one)
One of:
- Element named <growthRate> containing:
  - Parameter element (exactly one)
    A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
- Element named <doublingTime> containing:
  - Parameter element (exactly one)
    This parameter determines the doubling time.

Example:

<expConstExp> element

A demographic model of exponential growth.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)
Element named <relativePlateauSize> containing:
- Parameter element (exactly one)
  The size of plateau relative to modern population size.
Element named <relTimeModGrowth> containing:
- Parameter element (exactly one)
  The time spanned by modern growth phase relative to time back to start of plateau phase.
Element named <plateauStartTime> containing:
- Parameter element (exactly one)
  The time of the start of plateauPhase.
Element named <ancientGrowthRate> containing:
- Parameter element (exactly one)
  The growth rate of early growth phase

Example:

<exponentialDistributionModel> element

A model of an exponential distribution.

The element takes following attributes:

Attribute (optional) offset is Double

The element has the following contents:

One of:
- Element named <mean> containing:
  - Double element (exactly one)
- Element named <mean> containing:
  - Parameter element (exactly one)

Example:

<exponentialGrowth> element

A demographic model of exponential growth.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)
One of:
- Element named <growthRate> containing:
  - Parameter element (exactly one)
    A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
- Element named <doublingTime> containing:
  - Parameter element (exactly one)
    This parameter determines the doubling time.

Example:

<exponentialMarkovLikelihood> element

A continuous state, discrete time markov chain in which each new state is an exponentially distributed variable with a mean of the previous state.

The element takes following attributes:

Attribute (optional) jeffreys is Boolean
Attribute (optional) reverse is Boolean

The element has the following contents:

Element named <chainParameter> containing:
- Parameter element (exactly one)

Example:

<exponentialPrior> element

Calculates the prior probability of some data under a given exponential distribution.

The element takes following attributes:

Attribute mean is Double
Attribute offset is Double

The element has the following contents:

Statistic elements (one or more)

Example:

<exponentialSawtooth> element

A demographic model of succesive exponential growth and periodic population crashes.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)
Element named <growthRate> containing:
- Parameter element (exactly one)
  The rate of exponential growth during the growth phase.
Element named <wavelength> containing:
- Parameter element (exactly one)
  The wavelength between successive population crashes.
Element named <offset> containing:
- Parameter element (exactly one)
  The proportion of the last growth phase that is not achieved at the final sample time.

Example:

<expressionStatistic> element

This element returns a statistic that is the mean of the child statistics.

The element has the following contents:

Element named <expression> containing:
- String element (exactly one)
Element named <variables> containing:
- Statistic elements (one or more)

Example:

<fixedColouredOperator> element

This element (or a ColouredOperator) must wrap any operator that changes a parameter upon which the colouring proposal distribution depends

The element has the following contents:

MCMCOperator element (exactly one)
ColourSamplerModel element (exactly one)

Example:

<fixedColouredOperator>
<bitSwapOperator idref="bitSwapOperator9"/>
ERROR!
</fixedColouredOperator>

<frequencyModel> element

A model of equilibrium base frequencies.

The element has the following contents:

One of:
- Attribute dataType is String
  The type of sequence data
- DataType element (exactly one)

Element named <frequencies> containing:
- Parameter element (exactly one)

Example:

<gammaDistributionModel> element

Describes a gamma distribution with a given shape and scale that can be used in a distributionLikelihood element.

The element has the following contents:

Element named <shape> containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)

Element named <scale> containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)

Example:

<gammaPrior> element

Calculates the prior probability of some data under a given gamma distribution.

The element takes following attributes:

Attribute shape is Double
Attribute scale is Double
Attribute offset is Double

The element has the following contents:

Statistic elements (one or more)

Example:

<GDLikelihood> element

The likelihood of a set of rate changes in a tree, assuming a gamma-distributed change in rate at each node, with a mean of the previous rate and a given variance (variance can be optionally proportional to branch length).

The element takes following attributes:

Attribute stdev is Double
The unit stdev of the model. The variance is scaled by the branch length to get the actual variance in the non-episodic version of the model.
Attribute (optional) rootModel is String
specify the rate model to use at the root. Should be one of: 'meanOfChildren', 'meanOfAll', 'equalToChild', 'ignoreRoot' or 'none'.
Attribute episodic is Boolean
true if model is branch length independent, false if length-dependent.

The element has the following contents:

TreeModel element (exactly one)
Element named <rates> containing:
- Parameter element (exactly one)
  The branch rates parameter

Example:

<generalDataType> element

Defines a general DataType for any number of states

The element has the following contents:

<state code="X"/>*:<alias code="Y" state="X"/>*:<ambiguity code="Z" states="XY"/>

Example:

<generalDataType id="nucleotides">
<state code="A"/>
<state code="C"/>
<state code="G"/>
<state code="T"/>
<alias code="U" state="T"/>
<ambiguity code="R" states="AG"/>
<ambiguity code="Y" states="CT"/>
<ambiguity code="?" states="ACGT"/>
<ambiguity code="-" states="ACGT"/>
</generalDataType>

<generalizedSkylineGibbsOperator> element

This element returns a Gibbs operator for the joint distribution of population sizes.

The element takes following attributes:

Attribute (optional) linear is Boolean
Attribute weight is Integer
Attribute lower is Double
Attribute upper is Double
Attribute (optional) Jeffreys is Boolean
Attribute (optional) reverse is Boolean
Attribute (optional) exponentialMarkov is Boolean
Attribute shape is Double

The element has the following contents:

BayesianSkylineLikelihood element (exactly one)
Parameter element (exactly one)

Example:

<generalizedSkylineGibbsOperator linear="true" weight="1" lower="1.0" upper="1.0" Jeffreys="true" reverse="true" exponentialMarkov="true" shape="1.0">
ERROR!
<compoundParameter idref="compoundParameter3"/>
</generalizedSkylineGibbsOperator>

<generalizedSkyLineLikelihood> element

This element represents the likelihood of the tree given the population size vector.

The element takes following attributes:

Attribute (optional) linear is Boolean

The element has the following contents:

Element named <populationSizes> containing:
- Parameter element (exactly one)
Element named <groupSizes> containing:
- Parameter element (exactly one)
Element named <populationTree> containing:
- TreeModel element (exactly one)

Example:

<generalSubstitutionModel> element

A general reversible model of sequence substitution for any data type.

The element takes following attributes:

Attribute name is String
A name for this general substitution model

The element has the following contents:

One of:
- Attribute dataType is String
  The type of sequence data
- DataType element (exactly one)

Element named <frequencies> containing:
- FrequencyModel element (exactly one)
Element named <rates> containing:
- Attribute relativeTo is Integer
  The index of the implicit rate (value 1.0) that all other rates are relative to. In DNA this is usually G<->T (6)
- Parameter element (zero or one)

Example:

<gtrModel> element

A general reversible model of nucleotide sequence substitution.

The element has the following contents:

Element named <frequencies> containing:
- FrequencyModel element (exactly one)
Element named <rateAC> containing:
- Parameter element (exactly one)
Element named <rateAG> containing:
- Parameter element (exactly one)
Element named <rateAT> containing:
- Parameter element (exactly one)
Element named <rateCG> containing:
- Parameter element (exactly one)
Element named <rateCT> containing:
- Parameter element (exactly one)
Element named <rateGT> containing:
- Parameter element (exactly one)

Example:

<gtrModel id="gtr1">
<frequencies> <frequencyModel idref="freqs"/> </frequencies>
<rateAC> <parameter id="rateAC" value="1.0"/> </rateAC>
<rateAT> <parameter id="rateAT" value="1.0"/> </rateAT>
<rateCG> <parameter id="rateCG" value="1.0"/> </rateCG>
<rateCT> <parameter id="rateCT" value="1.0"/> </rateCT>
<rateGT> <parameter id="rateGT" value="1.0"/> </rateGT>
</gtrModel>

<hkyModel> element

This element represents an instance of the HKY85 (Hasegawa, Kishino & Yano, 1985) model of nucleotide evolution.

The element has the following contents:

Element named <frequencies> containing:
- FrequencyModel element (exactly one)
Element named <kappa> containing:
- Parameter element (exactly one)

Example:

<integer> element

returns an Integer. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as an Integer.

The element has the following contents:

One of:
- Attribute prompt is String
  A message displayed to the user when entering a value for this integer
- Integer element (exactly one)

Example:

<jeffreysPrior> element

Calculates the Jeffrey's prior for the given statistics.

The element has the following contents:

One of:
- Statistic elements (one or more)
- Element named <data> containing:
  - Statistic elements (one or more)

Example:

<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.

The element takes following attributes:

Attribute (optional) threads is Integer

The element has the following contents:

Likelihood elements (one or more)

Example:

<log> element

Logs one or more items at a given frequency to the screen or to a file

The element takes following attributes:

Attribute logEvery is Integer
Attribute (optional) fileName is String
The name of the file to send log output to. If no file name is specified then log is sent to standard output
Attribute (optional) title is String
The title of the log

The element has the following contents:

At least one of:**Columns elements (one or more)
- Loggable elements (one or more)
- Object elements (one or more)

Example:

<logisticGrowth> element

Logistic growth demographic model.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <populationSize> containing:
- Parameter element (exactly one)
  This parameter represents the carrying capacity (maximum population size). If the shape is very large then the current day population size will be very close to the carrying capacity.
One of:
- Element named <growthRate> containing:
  - Parameter element (exactly one)
    This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.
- Element named <doublingTime> containing:
  - Parameter element (exactly one)
    This parameter determines the doubling time at peak growth rate.

Element named <t50> containing:
- Parameter element (exactly one)
  This parameter represents the time in the past when the population had half of the carrying capacity (population size). It is therefore a positive number with the same units as divergence times. A scale operator is recommended with a starting value near zero. A lower bound of zero should be employed and an upper bound is required!

Example:

<logML> element

Logs one or more items every time the given likelihood improves

The element takes following attributes:

Attribute (optional) logEvery is Integer

The element has the following contents:

Element named <ml> containing:
- Likelihood element (exactly one)
At least one of:**Columns elements (one or more)
- Loggable elements (one or more)

Example:

<logNormalDistributionModel> element

Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element

The element takes following attributes:

Attribute meanInRealSpace is Boolean
Attribute (optional) offset is Double

The element has the following contents:

Element named <mean> containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)

One of:
- Element named <stdev> containing:
  - One of:
    - Parameter element (exactly one)
    - Double element (exactly one)

- Element named <prec> containing:
  - One of:
    - Parameter element (exactly one)
    - Double element (exactly one)

Example:

<logNormalPrior> element

Calculates the prior probability of some data under a given lognormal distribution.

The element takes following attributes:

Attribute mean is Double
Attribute stdev is Double
Attribute offset is Double
Attribute meanInRealSpace is Boolean

The element has the following contents:

Statistic elements (one or more)

Example:

<logTree> element

Logs a tree to a file

The element takes following attributes:

Attribute logEvery is Integer
Attribute (optional) fileName is String
The name of the file to send log output to. If no file name is specified then log is sent to standard output
Attribute (optional) title is String
The title of the log
Attribute (optional) nexusFormat is Boolean
Whether to use the NEXUS format for the tree log
Attribute (optional) sortTranslationTable is Boolean
Whether the translation table is sorted.
Attribute (optional) branchLengths is String
What units should the branch lengths be in

The element has the following contents:

Tree element (exactly one)
The tree which is to be logged
BranchRateController element (zero or one)
TreeColouringProvider element (zero or one)
Likelihood element (zero or one)
TreeAttributeProvider elements (zero or more)
NodeAttributeProvider elements (zero or more)
BranchAttributeProvider elements (zero or more)

Example:

<logTree logEvery="100" fileName="log.trees" nexusFormat="true">
<treeModel idref="treeModel1"/>
</logTree>

<marginalLikelihoodAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

Attribute fileName is String
The name of a BEAST log file (can not include trees, which should be logged separately
Attribute (optional) burnIn is Integer

Example:

<mcmc> element

This element returns an MCMC chain and runs the chain as a side effect.

The element takes following attributes:

Attribute chainLength is Integer
Attribute (optional) autoOptimize is Boolean
Attribute (optional) preBurnin is Integer
Attribute (optional) temperature is Double
Attribute (optional) fullEvaluation is Integer

The element has the following contents:

OperatorSchedule element (exactly one)
Likelihood element (exactly one)
Logger elements (one or more)

Example:

<meanStatistic> element

This element returns a statistic that is the mean of the child statistics.

The element has the following contents:

Statistic elements (one or more)

Example:

<mergePatterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.

The element has the following contents:

SiteList elements (one or more)

Example:

<metaPopulationModel> element

A model that represents a subdivided population.

The element has the following contents:

DemographicModel elements (one to 999)
Parameter element (zero or one)

Example:

<mixedDistributionLikelihood> element

Calculates the likelihood of some data given some mix of parametric distributions.

The element has the following contents:

Element named <distribution0> containing:
- ParametricDistributionModel element (exactly one)
Element named <distribution1> containing:
- ParametricDistributionModel element (exactly one)
Element named <data> containing:
- Statistic element (exactly one)
Element named <indicators> containing:
- Statistic element (exactly one)

Example:

<monophylyStatistic> element

A statistic that returns true if a given set of taxa are monophyletic for a given tree

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic for the purpose of logging

The element has the following contents:

TreeModel element (exactly one)
Element named <mrca> containing:
- Taxa element (exactly one)

Example:

<mrbayesDefaultModel> element

A speciation model that puts uniform prior on all possible unrooted topologies.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <artificialOutgroup> containing:
- Taxon element (exactly one)
Element named <branchLengthModel> containing:
- ParametricDistributionModel element (exactly one)

Example:

<narrowExchange> element

This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.

The element takes following attributes:

Attribute weight is Integer

The element has the following contents:

TreeModel element (exactly one)

Example:

<NDLikelihood> element

This element returns an object that can calculate the likelihood of rate changes in a tree under the assumption of normally distributed rate changes among lineages. Specifically, each branch is assumed to draw a rate from a normal distribution with mean of the rate in the parent branch and the given standard deviation (the variance can be optionally proportional to branch length).

The element takes following attributes:

Attribute stdev is Double
The unit stdev of the model. The variance is scaled by the branch length to get the actual variance in the non-episodic version of the model.
Attribute (optional) rootModel is String
specify the rate model to use at the root. Should be one of: 'meanOfChildren', 'meanOfAll', 'equalToChild', 'ignoreRoot' or 'none'.
Attribute episodic is Boolean
true if model is branch length independent, false if length-dependent.

The element has the following contents:

TreeModel element (exactly one)
Element named <rates> containing:
- Parameter element (exactly one)
  The branch rates parameter

Example:

<negate> element

This element returns a statistic that is the element-wise negation of the child statistic.

The element has the following contents:

Statistic element (exactly one)

Example:

<neighborJoiningTree> element

This element returns a neighbour-joining tree generated from the given distances.

The element has the following contents:

DistanceMatrix element (exactly one)

Example:

<newick> element

Constructs a tree from a NEWICK format tree description

The element takes following attributes:

Attribute (optional) usingDates is Boolean
Attribute (optional) rescaleHeight is Double
Attempt to rescale the tree to the given root height
Attribute (optional) units is String
The branch length units of this tree

The element has the following contents:

String element (exactly one)
The NEWICK format tree. Tip labels are taken to be Taxon IDs

Example:

<node> element

This element represents a node in a tree.

The element takes following attributes:

Attribute (optional) height is Double
the age of the node
Attribute (optional) rate is Double
the relative rate of evolution at this node - default is 1.0

The element has the following contents:

One of:
- Taxon element (exactly one)
  The taxon of this leaf node
- SimpleNode elements (exactly 2)
  The children of this internal node

Example:

<normalDistributionModel> element

Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element

The element has the following contents:

Element named <mean> containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)

Element named <stdev> containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)

Example:

<normalPrior> element

Calculates the prior probability of some data under a given normal distribution.

The element takes following attributes:

Attribute mean is Double
Attribute stdev is Double

The element has the following contents:

Statistic elements (one or more)

Example:

<operators> element

A simple operator scheduler

The element takes following attributes:

Attribute (optional) sequential is Boolean

The element has the following contents:

MCMCOperator elements (one or more)

Example:

<optimizer> element

This element returns a maximum likelihood heuristic optimizer and runs the optimization as a side effect.

The element takes following attributes:

Attribute chainLength is Integer

The element has the following contents:

OperatorSchedule element (exactly one)
Likelihood element (exactly one)
Logger elements (one or more)

Example:

<parameter> element

A real-valued parameter of one or more dimensions.

The element takes following attributes:

Attribute (optional) value is Double;
Attribute (optional) dimension is Integer
Attribute (optional) upper is Double;
Attribute (optional) lower is Double;

Example:

<parsimonyStateStatistic> element

A statistic that has as its value the parsimony state reconstruction of a binary state defined by a set of taxa at a given MRCA of a tree

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic for the purposes of logging

The element has the following contents:

TreeModel element (exactly one)
Element named <state> containing:
- Taxa element (exactly one)
Element named <mrca> containing:
- Taxa element (exactly one)

Example:

<parsimonyStatistic> element

A statistic that has as its value the parsimony tree length of a set of a binary state defined by a set of taxa for a given tree

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic primarily for the purposes of logging

The element has the following contents:

TreeModel element (exactly one)
Element named <state> containing:
- Taxa element (exactly one)

Example:

<patterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.

The element takes following attributes:

Attribute (optional) from is Integer
The site position to start at, default is 1 (the first position)
Attribute (optional) to is Integer
The site position to finish at, must be greater than from, default is length of given alignment
Attribute (optional) every is Integer
Determines how many sites are selected. A value of 3 will select every third site starting from from, default is 1 (every site)

The element has the following contents:

Element named <taxonList> containing:
- TaxonList element (exactly one)
Alignment element (exactly one)

Example:

<piecewisePopulation> element

This element represents a piecewise population model

The element takes following attributes:

Attribute units is String
the units
Attribute linear is Boolean

The element has the following contents:

Element named <epochSizes> containing:
- Parameter element (exactly one)
Element named <epochWidths> containing:
- Attribute widths is Double;

Example:

<poissonPrior> element

Calculates the prior probability of some data under a given poisson distribution.

The element takes following attributes:

Attribute mean is Double
Attribute offset is Double

The element has the following contents:

Statistic elements (one or more)

Example:

<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.

The element takes following attributes:

Attribute (optional) threads is Integer

The element has the following contents:

Likelihood elements (one or more)

Example:

<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.

The element takes following attributes:

Attribute (optional) threads is Integer

The element has the following contents:

Likelihood elements (one or more)

Example:

<product> element

This element returns a statistic that is the mean of the child statistics.

The element has the following contents:

Statistic elements (one or more)

Example:

<property> element

This element returns an object representing the named property of the given child object.

The element takes following attributes:

Attribute name is String
name of the property

The element has the following contents:

Object element (exactly one)

Example:

<randomLocalClockModel> element

This element returns an random local clock (RLC) model.Each branch either has a new independent rate or inherits the rate of the branch above it depending on the indicator vector.

The element takes following attributes:

Attribute ratesAreMultipliers is Boolean

The element has the following contents:

TreeModel element (exactly one)
Element named <rateIndicator> containing:
- Parameter element (exactly one)
  The rate change indicators parameter
Element named <rates> containing:
- Parameter element (exactly one)
  The rate changes parameter
Element named <clockRate> containing:
- Parameter element (exactly one)
  The mean rate across all local clocks

Example:

<randomWalkOperator> element

This element returns a random walk operator on a given parameter.

The element takes following attributes:

Attribute windowSize is Double
Attribute weight is Integer
Attribute (optional) autoOptimize is Boolean

The element has the following contents:

Parameter element (exactly one)

Example:

<rateCovarianceStatistic> element

A statistic that has as its value the covariance of parent and child branch rates

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic primarily for the purposes of logging

The element has the following contents:

TreeModel element (exactly one)
BranchRateModel element (exactly one)

Example:

<rateEpochBranchRates> element

This element provides a multiple epoch molecular clock model. All branches (or portions of them) have the same rate of molecular evolution within a given epoch.

The element has the following contents:

Element named <epoch> containing:
- Attribute transitionTime is Double
  The time of transition between this epoch and the previous one
- Parameter element (exactly one)
  The evolutionary rate parameter for this epoch
  An epoch that lasts until transitionTime
Element named <rate> containing:
- Parameter element (exactly one)
  The ancestral molecular evolutionary rate parameter

Example:

<rateExchange> element

An operator that exchanges rates and traits on a tree.

The element takes following attributes:

Attribute weight is Integer
Attribute swapRates is Boolean
Attribute swapTraits is Boolean
Attribute swapAtRoot is Boolean
Attribute moveHeight is Boolean

The element has the following contents:

TreeModel element (exactly one)

Example:

<rateStatistic> element

A statistic that returns the average of the branch rates

The element takes following attributes:

Attribute internal is Boolean
Attribute external is Boolean
Attribute mode is String
This attribute determines how the rates are summarized, can be one of (mean, variance, coefficientOfVariance)
Attribute (optional) name is String
A name for this statistic primarily for the purposes of logging

The element has the following contents:

TreeModel element (exactly one)
BranchRateModel element (exactly one)

Example:

<reciprocal> element

This element returns a statistic that is the element-wise reciprocal of the child statistic.

The element has the following contents:

Statistic element (exactly one)

Example:

<report> element

Generates a report using the given text and elements

The element takes following attributes:

Attribute (optional) type is String
The format of the report
Attribute (optional) title is String
The title of the report

The element has the following contents:

Object elements (one or more)
An arbitrary mixture of text and elements to report

Example:

<scaledPiecewisePopulation> element

This element represents a piecewise population model

The element takes following attributes:

Attribute units is String
the units
Attribute linear is Boolean

The element has the following contents:

Element named <populationSizes> containing:
- Parameter element (exactly one)
Element named <populationTree> containing:
- TreeModel element (exactly one)

Example:

<scaleOperator> element

This element returns a scale operator on a given parameter.

The element takes following attributes:

Attribute scaleFactor is Double
Attribute (optional) scaleAll is Boolean
Attribute weight is Integer
Attribute (optional) autoOptimize is Boolean
Attribute (optional) pickoneprob is Double

The element has the following contents:

Parameter element (exactly one)

Example:

<sequence> element

A biomolecular sequence.

The element has the following contents:

Taxon element (exactly one)
String element (exactly one)
A character string representing the aligned molecular sequence

Example:

<sequence>
<taxon idref="taxon7"/>
ACGACTAGCATCGAGCTTCG--GATAGCATGC
</sequence>

<setOperator> element

This element represents an operator on a set.

The element takes following attributes:

Attribute set is Double;

The element has the following contents:

Parameter element (exactly one)

Example:

<siteModel> element

A SiteModel that has a gamma distributed rates across sites

The element has the following contents:

Element named <substitutionModel> containing:
- SubstitutionModel element (exactly one)
One of:
- Element named <mutationRate> containing:
  - Parameter element (exactly one)
- Element named <relativeRate> containing:
  - Parameter element (exactly one)

Element named <gammaShape> containing:
- Attribute (optional) gammaCategories is Integer
- Parameter element (exactly one)
Element named <proportionInvariant> containing:
- Parameter element (exactly one)

Example:

<skyLineLikelihood> element

This element represents the likelihood of the tree given the population size vector.

The element has the following contents:

Element named <populationSizes> containing:
- Parameter element (exactly one)
Element named <populationTree> containing:
- TreeModel element (exactly one)

Example:

<speciationLikelihood> element

This element represents the likelihood of the tree given the speciation.

The element has the following contents:

Element named <model> containing:
- SpeciationModel element (exactly one)
Element named <speciesTree> containing:
- TreeModel element (exactly one)

Example:

<speciesTreeStatistic> element

A statistic that returns true if the given population tree is compatible with the species tree. Compatibility is defined as the compatibility of the timings of the events, so that incompatibility arises if two individuals in the population tree coalescent before their species do in the species tree.

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic primarily for the purposes of logging

The element has the following contents:

Element named <speciesTree> containing:
- Tree element (exactly one)
Element named <populationTree> containing:
- Tree element (exactly one)

Example:

<statistic> element

A statistic of a given name from the specified object.

The element takes following attributes:

Attribute name is String
The name of the statistic you wish to extract from the given object

The element has the following contents:

StatisticList element (exactly one)

Example:

<strictClockBranchRates> element

This element provides a strict clock model. All branches have the same rate of molecular evolution.

The element has the following contents:

Element named <rate> containing:
- Parameter element (exactly one)
  The molecular evolutionary rate parameter

Example:

<string> element

returns a String. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned.

The element has the following contents:

One of:
- Attribute prompt is String
  A message displayed to the user when entering a value for this string
- String element (exactly one)

Example:

<structuredCoalescentLikelihood> element

This element represents a likelihood function for transmission.

The element has the following contents:

TreeModel element (exactly one)
The tree.
ColourSamplerModel element (exactly one)
The colour sampler model.
MigrationModel element (exactly one)
The migration model.
MetaPopulationModel element (exactly one)
The meta-population model.

Example:

<structuredCoalescentLikelihood>
<treeModel idref="treeModel7"/>
ERROR!
<constantMigrationModel idref="constantMigrationModel4"/>
<metaPopulationModel idref="metaPopulationModel3"/>
</structuredCoalescentLikelihood>

<subtreeSlide> element

An operator that slides a subtree.

The element takes following attributes:

Attribute weight is Integer
Attribute size is Double
Attribute gaussian is Boolean
Attribute (optional) swapInRandomRate is Boolean
Attribute (optional) swapInRandomTrait is Boolean
Attribute (optional) autoOptimize is Boolean

The element has the following contents:

TreeModel element (exactly one)

Example:

<sumStatistic> element

This element returns a statistic that is the element-wise sum of the child statistics.

The element takes following attributes:

Attribute elementwise is Boolean

The element has the following contents:

Statistic elements (one or more)

Example:

<swapOperator> element

This element represents an operator that swaps values in a multi-dimensional parameter.

The element takes following attributes:

Attribute weight is Integer
Attribute size is Integer
Attribute autoOptimize is Boolean

The element has the following contents:

Parameter element (exactly one)

Example:

<taxa> element

Defines a set of taxon objects.

The element has the following contents:

At least one of:**Taxa elements (one or more)
- Taxon elements (one or more)

Example:

<taxa id="greatApes">
<taxon id="human"/>
<taxon id="chimp"/>
<taxon id="bonobo"/>
<taxon id="gorilla"/>
<taxon id="orangutan"/>
<taxon id="siamang"/>
</taxa>

<taxa id="humanAndChimps">
<taxon idref="human"/>
<taxon idref="chimp"/>
<taxon idref="bonobo"/>
</taxa>

<taxon> element

The element takes following attributes:

Attribute id is String
A unique identifier for this taxon

The element has the following contents:

Date element (zero or one)

Example:

<test> element

This element represents a boolean statistic that returns 1 if the conditions are met and 0 otherwise.

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic, for logging purposes

The element has the following contents:

Attribute element (exactly one)
One of:
- Element named <equals> containing:
  - Attribute element (exactly one)
- Element named <greaterThan> containing:
  - Attribute element (exactly one)
- Element named <lessThan> containing:
  - Attribute element (exactly one)
- Attribute equals is Double
- Attribute greaterThan is Double
- Attribute lessThan is Double
- Attribute inside is Double;
- Attribute outside is Double;

Example:

<tipHeightLikelihood> element

Calculates the likelihood of the tipHeights given some parametric or empirical distribution.

The element has the following contents:

Element named <distribution> containing:
- ParametricDistributionModel element (exactly one)
Element named <tipHeights> containing:
- Parameter element (exactly one)

Example:

<tkf91Likelihood> element

Returns the total likelihood of a single alignment under the TKF91 model, for a given tree. In particular all possible ancestral histories of insertions and deletions leading to the alignment of sequences at the tips are taken into account.

The element has the following contents:

TreeModel element (exactly one)
Alignment element (exactly one)
GammaSiteModel element (exactly one)
TKF91Model element (exactly one)

Example:

<tkf91Model> element

The TKF91 (Thorne, Kishino & Felsenstein 1991) model of insertion-deletion.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <lengthDistribution> containing:
- Parameter element (exactly one)
Element named <deathRate> containing:
- Parameter element (exactly one)

Example:

<tmrcaStatistic> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic primarily for the purposes of logging
Attribute (optional) rate is Boolean

The element has the following contents:

TreeModel element (exactly one)
Element named <mrca> containing:
- Taxa element (exactly one)

Example:

<traceAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

Attribute fileName is String
The name of a BEAST log file (can not include trees, which should be logged separately
Attribute (optional) burnIn is Integer

Example:

<tree> element

This element represents a rooted binary tree and associated attributes.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

SimpleNode element (exactly one)

Example:

<treeColouringOperator> element

A tree colouring model.

The element has the following contents:

ColourSamplerModel element (exactly one)

Example:

<treeColouringOperator>
ERROR!
</treeColouringOperator>

<treeLengthStatistic> element

A statistic that returns the average of the branch rates

The element has the following contents:

TreeModel element (exactly one)

Example:

<treeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

Attribute (optional) useAmbiguities is Boolean
Attribute (optional) storePartials is Boolean
Attribute (optional) useScaling is Boolean

The element has the following contents:

PatternList element (exactly one)
TreeModel element (exactly one)
SiteModel element (exactly one)
BranchRateModel element (zero or one)

Example:

<treeMetricStatistic> element

A statistic that returns the distance between two trees. with method="topology", return a 0 for identity and a 1 for difference. With other methods return the distance metric associated with that method.

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic primarily for the purposes of logging
Attribute (optional) method is String
comparision method (TOPOLOGY,BILLERA,ROBINSONSFOULD,CLADEHEIGHTM)

The element has the following contents:

Element named <target> containing:
- TreeModel element (exactly one)
Element named <reference> containing:
- Tree element (exactly one)

Example:

<treeModel> element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.

The element has the following contents:

Tree element (exactly one)
Element named <rootHeight> containing:
- Parameter element (exactly one)
  A parameter definition with id only (cannot be a reference!)
Element named <nodeHeights> containing:
- Attribute (optional) rootNode is Boolean
  If true the root height is included in the parameter
- Attribute (optional) internalNodes is Boolean
  If true the internal node heights (minus the root) are included in the parameter
- Parameter element (exactly one)
  A parameter definition with id only (cannot be a reference!)

Example:

<treeModel id="treeModel1">
<tree idref="startingTree"/>
<rootHeight>
<parameter id="treeModel1.rootHeight"/>
</rootHeight>
<nodeHeights internalNodes="true" rootNode="false">
<parameter id="treeModel1.internalNodeHeights"/>
</nodeHeights>
<nodeHeights internalNodes="true" rootNode="true">
<parameter id="treeModel1.allInternalNodeHeights"/>
</nodeHeights>
</treeModel>

<treeShapeStatistics> element

A statistic that reports a handful of tree shape statistics on the given target tree.

The element takes following attributes:

Attribute (optional) name is String
A name for this statistic primarily for the purposes of logging

The element has the following contents:

Element named <target> containing:
- TreeModel element (exactly one)

Example:

<treeTraceAnalysis> element

Analyses and reports on a trace consisting of trees.

The element takes following attributes:

Attribute fileName is String
name of a tree log file
Attribute (optional) burnIn is Integer

Example:

<twoEpoch> element

A demographic model of two epochs.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <modernEpoch> containing:
- DemographicModel element (exactly one)
  The demographic model for the recent epoch.
Element named <ancientEpoch> containing:
- DemographicModel element (exactly one)
  The demographic model for the ancient epoch.
Element named <transitionTime> containing:
- Parameter element (exactly one)
  The time that splits the two epochs.

Example:

<uniformDistributionModel> element

Describes a uniform distribution with a given lower and upper bounds

The element has the following contents:

Element named <lower> containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)

Element named <upper> containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)

Example:

<uniformOperator> element

An operator that picks new parameter values uniformly at random.

The element takes following attributes:

Attribute weight is Integer

The element has the following contents:

Parameter element (exactly one)

Example:

<uniformPrior> element

Calculates the prior probability of some data under a given uniform distribution.

The element takes following attributes:

Attribute lower is Double
Attribute upper is Double

The element has the following contents:

Statistic elements (one or more)

Example:

<uniformRootPrior> element

This element represents the likelihood of the tree given the demographic function.

The element takes following attributes:

Attribute maxRootHeight is Double

The element has the following contents:

TreeModel element (exactly one)

Example:

<upDownOperator> element

This element represents an operator that scales two parameters in different directions. Each operation involves selecting a scale uniformly at random between scaleFactor and 1/scaleFactor. The up parameter is multipled by this scale and the down parameter is divided by this scale.

The element takes following attributes:

Attribute scaleFactor is Double
Attribute weight is Integer
Attribute (optional) autoOptimize is Boolean

The element has the following contents:

Element named <up> containing:
- Parameter element (exactly one)
Element named <down> containing:
- Parameter element (exactly one)

Example:

<upgmaTree> element

This element returns a UPGMA tree generated from the given distances.

The element takes following attributes:

Attribute (optional) usingDates is Boolean
Attribute (optional) rootHeight is Double

The element has the following contents:

DistanceMatrix element (exactly one)

Example:

<varianceStatistic> element

This element returns a statistic that is the variance of the child statistics.

The element has the following contents:

Statistic elements (one or more)

Example:

<wideExchange> element

This element represents a wide exchange operator. This operator swaps two random subtrees.

The element takes following attributes:

Attribute weight is Integer

The element has the following contents:

TreeModel element (exactly one)

Example:

<wilsonBalding> element

An operator which performs the Wilson-Balding move on a tree

The element takes following attributes:

Attribute weight is Integer

The element has the following contents:

Element named <demographicModel> containing:
- ConstantPopulationModel element (exactly one)
TreeModel element (exactly one)

Example:

<yangCodonModel> element

This element represents the Yang model of codon evolution.

The element takes following attributes:

Attribute (optional) geneticCode is String
The genetic code to use

The element has the following contents:

Element named <omega> containing:
- Parameter element (exactly one)
Element named <kappa> containing:
- Parameter element (exactly one)
FrequencyModel element (exactly one)

Example:

<yuleModel> element

A speciation model of a Yule process.

The element takes following attributes:

Attribute units is String
the units

The element has the following contents:

Element named <birthRate> containing:
- Parameter element (exactly one)

Example:

BEAST types

The following is a list of generic types that elements represent in a beast file.

Alignment

Elements of this type include:

Attribute

Elements of this type include:

BayesianSkylineLikelihood

Elements of this type include:

Boolean

Elements of this type include:

BooleanStatistic

Elements of this type include:

BranchAttributeProvider

Elements of this type include:

BranchRateController

Elements of this type include:

BranchRateModel

Elements of this type include:

BranchingModel

Elements of this type include:

betaSplittingModel

ColourSamplerModel

Elements of this type include:

Columns

Elements of this type include:

column

ConstantPopulationModel

Elements of this type include:

constantSize

DataType

Elements of this type include:

generalDataType

Date

Elements of this type include:

date

DemographicModel

Elements of this type include:

DistanceMatrix

Elements of this type include:

distanceMatrix

Double

Elements of this type include:

double

Double;

Elements of this type include:

ExponentialGrowthModel

Elements of this type include:

exponentialGrowth

FrequencyModel

Elements of this type include:

frequencyModel

GammaSiteModel

Elements of this type include:

siteModel

Integer

Elements of this type include:

integer

Integer;

Elements of this type include:

Likelihood

Elements of this type include:

Loggable

Elements of this type include:

Logger

Elements of this type include:

MCMCOperator

Elements of this type include:

MetaPopulationModel

Elements of this type include:

metaPopulationModel

MigrationModel

Elements of this type include:

constantMigrationModel

Model

Elements of this type include:

NodeAttributeProvider

Elements of this type include:

randomLocalClockModel

OperatorSchedule

Elements of this type include:

operators

Parameter

Elements of this type include:

ParametricDistributionModel

Elements of this type include:

PatternList

Elements of this type include:

Sequence

Elements of this type include:

sequence

SimpleNode

Elements of this type include:

node

SiteList

Elements of this type include:

SiteModel

Elements of this type include:

siteModel

SpeciationModel

Elements of this type include:

Statistic

Elements of this type include:

StatisticList

Elements of this type include:

String

Elements of this type include:

string

String;

Elements of this type include:

SubstitutionModel

Elements of this type include:

TKF91Likelihood

Elements of this type include:

tkf91Likelihood

TKF91Model

Elements of this type include:

tkf91Model

Taxa

Elements of this type include:

taxa

Taxon

Elements of this type include:

taxon

TaxonList

Elements of this type include:

Tree

Elements of this type include:

TreeAttributeProvider

Elements of this type include:

TreeColouringProvider

Elements of this type include:

TreeModel

Elements of this type include:

treeModel

Return to contents

Main menu

Contents

You are here

BEAST XML Reference

Main menu

Contents

User login

You are here

BEAST XML Reference