BEAST XML Reference

From BEAST Software

Jump to: navigation, search

BEAST Documentation-> BEAST XML Reference

Contents

BEAST elements

The following is a list of valid elements in a beast file.

<advancedTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) storePartials is Boolean
  • Attribute (optional) useScaling is Boolean


The element has the following contents:

  • Element named <tips> containing:
    • SiteModel element (exactly one)
      A siteModel that will be applied only to the tips.
  • Element named <delta> containing:
    • Parameter element (exactly one)
      A parameter that specifies the amount of extra substitutions per site at each tip.
  • Element named <clade> containing:
    • Attribute (optional) includeStem is Boolean
      determines whether or not the stem branch above this clade is included in the siteModel.
    • Taxa element (exactly one)
      A set of taxa which defines a clade to apply a different site model to
    • SiteModel element (exactly one)
      A siteModel that will be applied only to this clade
  • PatternList element (exactly one)
  • TreeModel element (exactly one)
  • SiteModel element (exactly one)
  • BranchRateModel element (zero or one)


Example: 

<advancedTreeLikelihood useAmbiguities="true" storePartials="true" useScaling="true">
 <clade includeStem="true">
   <taxa idref="taxa5"/>
   <siteModel idref="siteModel3"/>
 </clade>
 <clade includeStem="true">
   <taxa idref="taxa3"/>
   <siteModel idref="siteModel3"/>
 </clade>
 <clade includeStem="true">
   <taxa idref="taxa3"/>
   <siteModel idref="siteModel1"/>
 </clade>
  <patterns idref="patterns1"/>
  <treeModel idref="treeModel10"/>
  <siteModel idref="siteModel6"/>
</advancedTreeLikelihood>


<alignment> element

This element represents an alignment of molecular sequences.


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The data type
    • DataType element (exactly one)


Example: 

<!-- An alignment of three short DNA sequences -->
<alignment missing="-?" dataType="nucleotide">
  <sequence>
    <taxon idref="taxon1"/>
    ACGACTAGCATCGAGCTTCG--GATAGCAGGC
  </sequence>
  <sequence>
    <taxon idref="taxon2"/>
    ACGACTAGCATCGAGCTTCGG-GATAGCATGC
  </sequence>
  <sequence>
    <taxon idref="taxon3"/>
    ACG?CTAGAATCGAGCTTCGAGGATAGCATGC
  </sequence>
</alignment>


<alignmentChunkOperator> element

This element represents an operator that re-aligns a small chunk of an alignment.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute iP is Double
    tuning probability, values near zero resamples entire alignment and near 1.0 resamples single columns.
  • Attribute exponent is Double
    tuning parameter, value of 1.0 samples random alignments, large values (e.g. 2.7) sample alignment peaked around 'best' alignment
  • Attribute gapPenalty is Double
    tuning parameter, must be negative, large values penalize gaps more in the alignment proposal.


The element has the following contents:


Example: 

<alignmentChunkOperator weight="1" iP="1.0" exponent="1.0" gapPenalty="1.0">
  <tkf91Likelihood idref="tkf91Likelihood7"/>
</alignmentChunkOperator>


<aminoAcidModel> element

An empirical amino acid substitution model.


The element takes following attributes:

  • Attribute type is String
    The type of empirical amino-acid rate matrix


The element has the following contents:

  • Element named <frequencies> containing:
    • FrequencyModel element (exactly one)
      If the frequencies are omitted than the empirical frequencies associated with the selected model are used.


Example: 

<aminoAcidModel type="WAG"/>


<array> element

This element returns an array of the objects it contains.


The element has the following contents:

  • Object elements (one or more)
    Objects to be put in an array


Example: 

<array>
  <upDownOperator idref="upDownOperator2"/>
  <yuleModel idref="yuleModel6"/>
  <compoundLikelihood idref="compoundLikelihood8"/>
</array>


<attr> element

This element represents a name/value pair.


The element takes following attributes:

  • Attribute name is String
    The name to give to this attribute


The element has the following contents:


Example: 

<attr name="foo">
  <scaledPiecewisePopulation idref="scaledPiecewisePopulation6"/>
</attr>


<attributes> element

This element represents an array of name/value pairs.


The element takes following attributes:


Example: 

<attributes names="foo bar" values="foo bar"/>


<betaSplittingModel> element

The beta-splitting family of tree branching models (Aldous, 1996;2001).


The element has the following contents:

  • Element named <phi> containing:
    • Parameter element (exactly one)
      A parameter that ranges from -infinity (comb-tree) to +infinity (balanced tree)
  • Element named <branchingTree> containing:
    • Tree element (exactly one)


Example: 

<betaSplittingModel>
 <phi>
   <compoundParameter idref="compoundParameter2"/>
 </phi>
 <branchingTree>
   <upgmaTree idref="upgmaTree3"/>
 </branchingTree>
</betaSplittingModel>


<binomialLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.


The element has the following contents:

  • Element named <trials> containing:
  • Element named <proportion> containing:
  • Element named <counts> containing:


Example: 

<binomialLikelihood>
 <trials>
   <compoundParameter idref="compoundParameter6"/>
 </trials>
 <proportion>
   <parameter idref="parameter1"/>
 </proportion>
 <counts values="1 2 4 8"/>
</binomialLikelihood>


<birthDeathModel> element

The Yang & Rannala (1997) model of speciation.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <birthRate> containing:
  • Element named <deathRate> containing:
  • Element named <samplingProportion> containing:


Example: 

<birthDeathModel units="mutations">
 <birthRate>
   <parameter idref="parameter7"/>
 </birthRate>
 <deathRate>
   <parameter idref="parameter1"/>
 </deathRate>
 <samplingProportion>
   <parameter idref="parameter9"/>
 </samplingProportion>
</birthDeathModel>


<bitFlipOperator> element

This element returns a bit-flip operator on a given parameter.


The element takes following attributes:


The element has the following contents:


Example: 

<bitFlipOperator weight="1">
  <compoundParameter idref="compoundParameter8"/>
</bitFlipOperator>


<bitSwapOperator> element

This element returns a bit-swap operator on a given parameter and data.


The element takes following attributes:


The element has the following contents:

  • Element named <data> containing:
  • Element named <indicators> containing:


Example: 

<bitSwapOperator weight="1">
 <data>
   <negate idref="negate6"/>
 </data>
 <indicators>
   <negate idref="negate3"/>
 </indicators>
</bitSwapOperator>


<booleanLikelihood> element

A function that log likelihood of a set of boolean statistics. If all the statistics are true then it returns 0.0 otherwise -infinity.


The element has the following contents:


Example: 

<booleanLikelihood>
  <test idref="test3"/>
  <test idref="test4"/>
</booleanLikelihood>


<branchingLikelihood> element

This element represents the likelihood of the tree given the demographic function.


The element has the following contents:

  • Element named <model> containing:
  • Element named <branchingTree> containing:


Example: 

<branchingLikelihood>
 <model>
   <betaSplittingModel idref="betaSplittingModel5"/>
 </model>
 <branchingTree>
   <treeModel idref="treeModel6"/>
 </branchingTree>
</branchingLikelihood>


<cataclysm> element

A demographic model of exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <growthRate> containing:
    • Parameter element (exactly one)
      The rate of exponential growth before the cataclysmic event.
  • Element named <spikeFactor> containing:
    • Parameter element (exactly one)
      The factor larger the population size was at its height.
  • Element named <timeOfCataclysm> containing:
    • Parameter element (exactly one)
      The time of the cataclysmic event that lead to exponential decline.


Example: 

<cataclysm units="substitutions">
 <populationSize>
   <parameter idref="parameter10"/>
 </populationSize>
 <growthRate>
   <parameter idref="parameter2"/>
 </growthRate>
 <spikeFactor>
   <compoundParameter idref="compoundParameter5"/>
 </spikeFactor>
 <timeOfCataclysm>
   <parameter idref="parameter9"/>
 </timeOfCataclysm>
</cataclysm>


<centeredScale> element

A centered-scale operator. This operator scales the the values of a multi-dimensional parameter so as to perserve the mean. It does this by expanding or conrtacting the parameter values around the mean.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute scaleFactor is Double
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example: 

<centeredScale weight="1" scaleFactor="1.0" autoOptimize="true">
  <compoundParameter idref="compoundParameter9"/>
</centeredScale>


<coalescentLikelihood> element

This element represents the likelihood of the tree given the demographic function.


The element has the following contents:

  • Element named <model> containing:
  • Element named <populationTree> containing:


Example: 

<coalescentLikelihood>
 <populationTree>
   <treeModel idref="treeModel10"/>
 </populationTree>
</coalescentLikelihood>


<coalescentMRCALikelihood> element

A coalescent likelihood function for a subtree.


The element has the following contents:

  • Element named <model> containing:
  • Element named <populationTree> containing:
  • Element named <mrca> containing:
    • Taxa element (exactly one)
  • Element named <exclude> containing:
    • Taxa elements (one or more)


Example: 

<coalescentMRCALikelihood>
 <model>
   <constantExponential idref="constantExponential6"/>
 </model>
 <populationTree>
   <treeModel idref="treeModel7"/>
 </populationTree>
 <mrca>
   <taxa idref="taxa8"/>
 </mrca>
</coalescentMRCALikelihood>


<coalescentTree> element

This element returns a simulated tree under the given demographic model.


The element takes following attributes:

  • Attribute (optional) rescaleHeight is Double
    Attempt to rescale the tree to the given root height


The element has the following contents:


Example: 

<coalescentTree rescaleHeight="1.0">
  <exponentialGrowth idref="exponentialGrowth2"/>
</coalescentTree>


<colouredNarrowExchange> element

This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.


The element takes following attributes:


The element has the following contents:


Example: 

<colouredNarrowExchange weight="1">
  <treeModel idref="treeModel4"/>
  ERROR!
</colouredNarrowExchange>


<colouredOperator> element

This element represents an arbitrary operator immediately followed by a re-colouring of the tree


The element has the following contents:


Example: 

<colouredOperator>
  <rateExchange idref="rateExchange8"/>
  ERROR!
</colouredOperator>


<colouredSubtreeSlide> element

An operator that slides a subtree.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute size is Double
  • Attribute gaussian is Boolean
  • Attribute (optional) swapRates is Boolean
  • Attribute (optional) swapTraits is Boolean
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example: 

<colouredSubtreeSlide weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
  <treeModel idref="treeModel6"/>
  ERROR!
</colouredSubtreeSlide>


<colouredWideExchange> element

This element represents a wide exchange operator. This operator swaps two random subtrees.


The element takes following attributes:


The element has the following contents:


Example: 

<colouredWideExchange weight="1">
  ERROR!
  <treeModel idref="treeModel8"/>
</colouredWideExchange>


<colourSamplerModel> element

This element represents a likelihood function for transmission.


The element has the following contents:

  • One of:
    • Element named <colours> containing:
      • Taxa elements (one or more)
        Taxa for each subsequent colour (after 0).
    • Alignment element (exactly one)
      The alignment.


Example: 

<colourSamplerModel>
 <colours>
   <taxa idref="taxa6"/>
   <taxa idref="taxa2"/>
   <taxa idref="taxa4"/>
 </colours>
  <treeModel idref="treeModel2"/>
  <constantMigrationModel idref="constantMigrationModel4"/>
  <metaPopulationModel idref="metaPopulationModel5"/>
</colourSamplerModel>


<column> element

Specifies formating options for one or more columns in a log file.


The element takes following attributes:

  • Attribute (optional) label is String
    The label of the column. If this is specified and more than one statistic is in this column, then the label will be appended by the index of the statistic to create individual column names
  • Attribute (optional) sf is Integer
  • Attribute (optional) dp is Integer
  • Attribute (optional) width is Integer


Example: 

<column label="foo" sf="1" dp="1" width="1"/>


<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) threads is Integer


The element has the following contents:


Example: 

<compoundLikelihood threads="1">
  <binomialLikelihood idref="binomialLikelihood7"/>
  <normalPrior idref="normalPrior8"/>
  <compoundLikelihood idref="compoundLikelihood1"/>
  <advancedTreeLikelihood idref="advancedTreeLikelihood1"/>
</compoundLikelihood>


<compoundParameter> element

A multidimensional parameter constructed from its component parameters.


The element has the following contents:


Example: 

<compoundParameter>
  <parameter idref="parameter1"/>
  <compoundParameter idref="compoundParameter2"/>
  <compoundParameter idref="compoundParameter5"/>
</compoundParameter>


<constantExponential> element

A demographic model of constant population size followed by exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <growthPhaseStartTime> containing:
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time.


Example: 

<constantExponential units="months">
 <populationSize>
   <compoundParameter idref="compoundParameter1"/>
 </populationSize>
 <growthPhaseStartTime>
   <compoundParameter idref="compoundParameter2"/>
 </growthPhaseStartTime>
 <doublingTime>
   <parameter idref="parameter4"/>
 </doublingTime>
</constantExponential>


<constantLogistic> element

A demographic model of constant population size followed by logistic growth.


The element takes following attributes:

  • Attribute units is String
    the units
  • Attribute alpha is Double


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <ancestralPopulationSize> containing:
  • Element named <growthRate> containing:
  • Element named <shape> containing:


Example: 

<constantLogistic units="months" alpha="1.0">
 <populationSize>
   <parameter idref="parameter4"/>
 </populationSize>
 <ancestralPopulationSize>
   <parameter idref="parameter7"/>
 </ancestralPopulationSize>
 <growthRate>
   <parameter idref="parameter9"/>
 </growthRate>
 <shape>
   <parameter idref="parameter9"/>
 </shape>
</constantLogistic>


<constantMigrationModel> element

A migration model representing constant migration rates through time.


The element has the following contents:

  • Element named <migrationRates> containing:


Example: 

<constantMigrationModel>
 <migrationRates>
   <parameter idref="parameter7"/>
 </migrationRates>
</constantMigrationModel>


<constantSize> element

A demographic model representing a constant population size through time.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:


Example: 

<constantSize units="mutations">
 <populationSize>
   <compoundParameter idref="compoundParameter10"/>
 </populationSize>
</constantSize>


<convert> element

Converts an alignment to the given data type.


The element takes following attributes:

  • Attribute dataType is String
    The type of sequence data


The element has the following contents:


Example: 

<convert dataType="amino acid">
  <convert idref="convert4"/>
</convert>


<covarionModel> element

A covarion substitution model of langauge evolution with binary data and a hidden rate state with two rates.


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <alpha> containing:
  • Element named <beta> containing:
  • Element named <gamma> containing:


Example: 

<covarionModel>
 <frequencies>
   <frequencyModel idref="frequencyModel2"/>
 </frequencies>
 <alpha/>
 <beta/>
 <gamma/>
</covarionModel>


<date> element

Specifies a date on a given timescale


The element takes following attributes:

  • Attribute value is String
    The value of this date
  • Attribute (optional) origin is String
    The origin of this time scale, which must be a valid calendar date
  • Attribute (optional) units is String
    The units of the timescale
  • Attribute (optional) direction is String
    The direction of the timescale


Example: 

<!-- a date representing 10 years in the past                                 -->
<date value="10.0" units="years" direction="backwards"/>

<!-- a date representing 300 days after Jan 1st 1989                          -->
<date value="300.0" origin="01/01/89" units="days" direction="forwards"/>


<deltaExchange> element

This element returns a scale operator on a given parameter.


The element takes following attributes:

  • Attribute delta is Double
  • Attribute (optional) parameterWeights is Integer;
  • Attribute weight is Integer
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) integer is Boolean


The element has the following contents:


Example: 

<deltaExchange delta="1.0" parameterWeights="1 2 4 8" weight="1" autoOptimize="true" integer="true">
  <compoundParameter idref="compoundParameter9"/>
</deltaExchange>


<discretizedBranchRates> element

This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.


The element takes following attributes:

  • Attribute (optional) singleRootRate is Boolean
    Whether only a single rate should be used for the two children branches of the root


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <distribution> containing:
  • Element named <rateCategories> containing:
    • Parameter element (exactly one)
      The rate categories parameter


Example: 

<discretizedBranchRates singleRootRate="true">
  <treeModel idref="treeModel6"/>
 <distribution>
   <normalDistributionModel idref="normalDistributionModel5"/>
 </distribution>
 <rateCategories>
   <parameter idref="parameter9"/>
 </rateCategories>
</discretizedBranchRates>


<distanceMatrix> element

Constructs a distance matrix from a pattern list or alignment


The element takes following attributes:

  • Attribute correction is String
    The type of distance correction used


The element has the following contents:


Example: 

<distanceMatrix correction="F84">
  <patterns idref="patterns1"/>
</distanceMatrix>


<distributionLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.


The element has the following contents:


Example: 

<distributionLikelihood>
 <distribution>
   <logNormalDistributionModel idref="logNormalDistributionModel9"/>
 </distribution>
 <data>
   <treeShapeStatistics idref="treeShapeStatistics10"/>
   <rateStatistic idref="rateStatistic6"/>
   <parsimonyStateStatistic idref="parsimonyStateStatistic5"/>
 </data>
</distributionLikelihood>


<double> element

returns a Double. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as a Double.


The element has the following contents:

  • One of:
    • Attribute prompt is String
      A message displayed to the user when entering a value for this double
    • Double element (exactly one)


Example: 

<double prompt="Enter the length of a piece of string (in metres):"/>


<dummyLikelihood> element

A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.


The element has the following contents:

  • Model element (exactly one)
    A model element


Example: 

<dummyLikelihood>
  <empiricalPiecewise idref="empiricalPiecewise1"/>
</dummyLikelihood>


<EDLikelihood> element

This element returns an object that can calculate the likelihood of rate changes in a tree under the assumption of exponentially distributed rate changes among lineages. Specifically, each branch is assumed to draw a rate from an exponential distribution with mean of the rate in the parent branch.


The element takes following attributes:

  • Attribute (optional) rootModel is String
    specify the rate model to use at the root. Should be one of: 'meanOfChildren', 'meanOfAll', 'equalToChild', 'ignoreRoot' or 'none'.


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The branch rates parameter


Example: 

<EDLikelihood rootModel="foo">
  <treeModel idref="treeModel3"/>
 <rates>
   <parameter idref="parameter8"/>
 </rates>
</EDLikelihood>


<empiricalDistributionLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.


The element has the following contents:

  • One of:
    • Element named <logFile> containing:
      • Attribute fileName is String
        The file name of an BEAST log file
      • Attribute statistic is String
        The name of the column in the log file that will be used as an empirical distribution
      • Attribute burnIn is Integer
      • Attribute (optional) delta is Boolean
    • Element named <histogram> containing:
      • X,Y data describing the distribution***:
  • Element named <data> containing:


Example: 

<empiricalDistributionLikelihood>
 <logFile fileName="foo" statistic="foo" burnIn="1" delta="true"/>
 <data>
   <exp idref="exp7"/>
   <product idref="product9"/>
   <rateCovarianceStatistic idref="rateCovarianceStatistic1"/>
 </data>
</empiricalDistributionLikelihood>


<empiricalPiecewise> element

This element represents a piecewise population model


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <intervalWidths> containing:
  • Element named <populationSizes> containing:
    • Parameter element (exactly one)
      The effective population sizes of each interval.
  • Element named <generationLength> containing:
    • Parameter element (exactly one)
      The scale factor.
  • Element named <threshold> containing:
    • Parameter element (exactly one)
      The threshold before counts occur.
  • Element named <lag> containing:
    • Parameter element (exactly one)
      The lag between actual population sizes and genetic diversity.


Example: 

<empiricalPiecewise units="years">
 <intervalWidths values="0.5 1.0"/>
 <populationSizes>
   <compoundParameter idref="compoundParameter1"/>
 </populationSizes>
 <generationLength>
   <compoundParameter idref="compoundParameter6"/>
 </generationLength>
 <threshold>
   <parameter idref="parameter5"/>
 </threshold>
 <lag>
   <parameter idref="parameter8"/>
 </lag>
</empiricalPiecewise>


<exp> element

This element returns a statistic that is the element-wise exponentiation of the child statistic.


The element has the following contents:


Example: 

<exp>
  <expressionStatistic idref="expressionStatistic1"/>
</exp>


<expansion> element

A demographic model of constant population size followed by exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <ancestralPopulationProportion> containing:
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time.


Example: 

<expansion units="mutations">
 <populationSize>
   <compoundParameter idref="compoundParameter5"/>
 </populationSize>
 <ancestralPopulationProportion>
   <compoundParameter idref="compoundParameter6"/>
 </ancestralPopulationProportion>
 <growthRate>
   <parameter idref="parameter4"/>
 </growthRate>
</expansion>


<expConstExp> element

A demographic model of exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <relativePlateauSize> containing:
    • Parameter element (exactly one)
      The size of plateau relative to modern population size.
  • Element named <relTimeModGrowth> containing:
    • Parameter element (exactly one)
      The time spanned by modern growth phase relative to time back to start of plateau phase.
  • Element named <plateauStartTime> containing:
    • Parameter element (exactly one)
      The time of the start of plateauPhase.
  • Element named <ancientGrowthRate> containing:
    • Parameter element (exactly one)
      The growth rate of early growth phase


Example: 

<expConstExp units="days">
 <populationSize>
   <parameter idref="parameter9"/>
 </populationSize>
 <relativePlateauSize>
   <compoundParameter idref="compoundParameter5"/>
 </relativePlateauSize>
 <relTimeModGrowth>
   <parameter idref="parameter9"/>
 </relTimeModGrowth>
 <plateauStartTime>
   <compoundParameter idref="compoundParameter4"/>
 </plateauStartTime>
 <ancientGrowthRate>
   <compoundParameter idref="compoundParameter9"/>
 </ancientGrowthRate>
</expConstExp>


<exponentialDistributionModel> element

A model of an exponential distribution.


The element takes following attributes:

  • Attribute (optional) offset is Double


The element has the following contents:

  • One of:
    • Element named <mean> containing:
    • Element named <mean> containing:


Example: 

<exponentialDistributionModel offset="1.0">
 <mean>
   1.0
 </mean>
</exponentialDistributionModel>


<exponentialGrowth> element

A demographic model of exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time.


Example: 

<exponentialGrowth units="years">
 <populationSize>
   <compoundParameter idref="compoundParameter1"/>
 </populationSize>
 <doublingTime>
   <parameter idref="parameter5"/>
 </doublingTime>
</exponentialGrowth>


<exponentialMarkovLikelihood> element

A continuous state, discrete time markov chain in which each new state is an exponentially distributed variable with a mean of the previous state.


The element takes following attributes:

  • Attribute (optional) jeffreys is Boolean
  • Attribute (optional) reverse is Boolean


The element has the following contents:

  • Element named <chainParameter> containing:


Example: 

<exponentialMarkovLikelihood jeffreys="true" reverse="true">
 <chainParameter>
   <parameter idref="parameter3"/>
 </chainParameter>
</exponentialMarkovLikelihood>


<exponentialPrior> element

Calculates the prior probability of some data under a given exponential distribution.


The element takes following attributes:


The element has the following contents:


Example: 

<exponentialPrior mean="1.0" offset="1.0">
  <exp idref="exp9"/>
  <treeShapeStatistics idref="treeShapeStatistics5"/>
  <monophylyStatistic idref="monophylyStatistic5"/>
</exponentialPrior>


<exponentialSawtooth> element

A demographic model of succesive exponential growth and periodic population crashes.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <growthRate> containing:
    • Parameter element (exactly one)
      The rate of exponential growth during the growth phase.
  • Element named <wavelength> containing:
    • Parameter element (exactly one)
      The wavelength between successive population crashes.
  • Element named <offset> containing:
    • Parameter element (exactly one)
      The proportion of the last growth phase that is not achieved at the final sample time.


Example: 

<exponentialSawtooth units="substitutions">
 <populationSize>
   <parameter idref="parameter5"/>
 </populationSize>
 <growthRate>
   <parameter idref="parameter1"/>
 </growthRate>
 <wavelength>
   <compoundParameter idref="compoundParameter4"/>
 </wavelength>
 <offset>
   <parameter idref="parameter2"/>
 </offset>
</exponentialSawtooth>


<expressionStatistic> element

This element returns a statistic that is the mean of the child statistics.


The element has the following contents:

  • Element named <expression> containing:
  • Element named <variables> containing:


Example: 

<expressionStatistic>
 <expression>
   foo
 </expression>
 <variables>
   <parameter idref="parameter2"/>
   <sumStatistic idref="sumStatistic9"/>
   <parsimonyStatistic idref="parsimonyStatistic9"/>
 </variables>
</expressionStatistic>


<fixedColouredOperator> element

This element (or a ColouredOperator) must wrap any operator that changes a parameter upon which the colouring proposal distribution depends


The element has the following contents:


Example: 

<fixedColouredOperator>
  <bitSwapOperator idref="bitSwapOperator9"/>
  ERROR!
</fixedColouredOperator>


<frequencyModel> element

A model of equilibrium base frequencies.


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <frequencies> containing:


Example: 

<frequencyModel>
  <generalDataType idref="generalDataType6"/>
 <frequencies>
   <compoundParameter idref="compoundParameter8"/>
 </frequencies>
</frequencyModel>


<gammaDistributionModel> element

Describes a gamma distribution with a given shape and scale that can be used in a distributionLikelihood element.


The element has the following contents:

  • Element named <shape> containing:
  • Element named <scale> containing:


Example: 

<gammaDistributionModel>
 <shape>
   1.0
 </shape>
 <scale>
   1.0
 </scale>
</gammaDistributionModel>


<gammaPrior> element

Calculates the prior probability of some data under a given gamma distribution.


The element takes following attributes:


The element has the following contents:


Example: 

<gammaPrior shape="1.0" scale="1.0" offset="1.0">
  <treeMetricStatistic idref="treeMetricStatistic10"/>
  <parsimonyStatistic idref="parsimonyStatistic2"/>
  <tmrcaStatistic idref="tmrcaStatistic8"/>
</gammaPrior>


<GDLikelihood> element

The likelihood of a set of rate changes in a tree, assuming a gamma-distributed change in rate at each node, with a mean of the previous rate and a given variance (variance can be optionally proportional to branch length).


The element takes following attributes:

  • Attribute stdev is Double
    The unit stdev of the model. The variance is scaled by the branch length to get the actual variance in the non-episodic version of the model.
  • Attribute (optional) rootModel is String
    specify the rate model to use at the root. Should be one of: 'meanOfChildren', 'meanOfAll', 'equalToChild', 'ignoreRoot' or 'none'.
  • Attribute episodic is Boolean
    true if model is branch length independent, false if length-dependent.


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The branch rates parameter


Example: 

<GDLikelihood stdev="1.0" rootModel="foo" episodic="true">
  <treeModel idref="treeModel4"/>
 <rates>
   <compoundParameter idref="compoundParameter9"/>
 </rates>
</GDLikelihood>


<generalDataType> element

Defines a general DataType for any number of states


The element has the following contents:

  • <state code="X"/>*:<alias code="Y" state="X"/>*:<ambiguity code="Z" states="XY"/>

Example: 

<!-- The XML for a nucleotide data type under this scheme would be -->
<generalDataType id="nucleotides">
	<state code="A"/>
	<state code="C"/>
	<state code="G"/>
	<state code="T"/>
	<alias code="U" state="T"/>
	<ambiguity code="R" states="AG"/>
	<ambiguity code="Y" states="CT"/>
	<ambiguity code="?" states="ACGT"/>
	<ambiguity code="-" states="ACGT"/>
</generalDataType>


<generalizedSkylineGibbsOperator> element

This element returns a Gibbs operator for the joint distribution of population sizes.


The element takes following attributes:

  • Attribute (optional) linear is Boolean
  • Attribute weight is Integer
  • Attribute lower is Double
  • Attribute upper is Double
  • Attribute (optional) Jeffreys is Boolean
  • Attribute (optional) reverse is Boolean
  • Attribute (optional) exponentialMarkov is Boolean
  • Attribute shape is Double


The element has the following contents:


Example: 

<generalizedSkylineGibbsOperator linear="true" weight="1" lower="1.0" upper="1.0" Jeffreys="true" reverse="true" exponentialMarkov="true" shape="1.0">
  ERROR!
  <compoundParameter idref="compoundParameter3"/>
</generalizedSkylineGibbsOperator>


<generalizedSkyLineLikelihood> element

This element represents the likelihood of the tree given the population size vector.


The element takes following attributes:

  • Attribute (optional) linear is Boolean


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <groupSizes> containing:
  • Element named <populationTree> containing:


Example: 

<generalizedSkyLineLikelihood linear="true">
 <populationSizes>
   <compoundParameter idref="compoundParameter1"/>
 </populationSizes>
 <groupSizes>
   <parameter idref="parameter9"/>
 </groupSizes>
 <populationTree>
   <treeModel idref="treeModel9"/>
 </populationTree>
</generalizedSkyLineLikelihood>


<generalSubstitutionModel> element

A general reversible model of sequence substitution for any data type.


The element takes following attributes:

  • Attribute name is String
    A name for this general substitution model


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <frequencies> containing:
  • Element named <rates> containing:
    • Attribute relativeTo is Integer
      The index of the implicit rate (value 1.0) that all other rates are relative to. In DNA this is usually G<->T (6)
    • Parameter element (zero or one)


Example: 

<generalSubstitutionModel dataType="binary" name="foo">
 <frequencies>
   <frequencyModel idref="frequencyModel8"/>
 </frequencies>
 <rates relativeTo="1"/>
</generalSubstitutionModel>


<gtrModel> element

A general reversible model of nucleotide sequence substitution.


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <rateAC> containing:
  • Element named <rateAG> containing:
  • Element named <rateAT> containing:
  • Element named <rateCG> containing:
  • Element named <rateCT> containing:
  • Element named <rateGT> containing:


Example: 

<!-- A general time reversible model for DNA.                                          -->
<!-- This element must have parameters for exactly five of the six rates               -->
<!-- The sixth rate has an implied value of 1.0 and all other rates are relative to it -->
<!-- This example parameterizes the rate matrix relative to the A<->G transition       -->
<gtrModel id="gtr1">
	<frequencies> <frequencyModel idref="freqs"/> </frequencies>
	<rateAC> <parameter id="rateAC" value="1.0"/> </rateAC>
	<rateAT> <parameter id="rateAT" value="1.0"/> </rateAT>
	<rateCG> <parameter id="rateCG" value="1.0"/> </rateCG>
	<rateCT> <parameter id="rateCT" value="1.0"/> </rateCT>
	<rateGT> <parameter id="rateGT" value="1.0"/> </rateGT>
</gtrModel>


<hkyModel> element

This element represents an instance of the HKY85 (Hasegawa, Kishino & Yano, 1985) model of nucleotide evolution.


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <kappa> containing:


Example: 

<hkyModel>
 <frequencies>
   <frequencyModel idref="frequencyModel4"/>
 </frequencies>
 <kappa>
   <parameter idref="parameter5"/>
 </kappa>
</hkyModel>


<integer> element

returns an Integer. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as an Integer.


The element has the following contents:

  • One of:
    • Attribute prompt is String
      A message displayed to the user when entering a value for this integer
    • Integer element (exactly one)


Example: 

<integer>
  1
</integer>


<jeffreysPrior> element

Calculates the Jeffrey's prior for the given statistics.


The element has the following contents:

  • One of:
    • Statistic elements (one or more)
    • Element named <data> containing:


Example: 

<jeffreysPrior>
  <parameter idref="parameter10"/>
  <parameter idref="parameter1"/>
</jeffreysPrior>


<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) threads is Integer


The element has the following contents:


Example: 

<compoundLikelihood threads="1">
  <structuredCoalescentLikelihood idref="structuredCoalescentLikelihood2"/>
  <dummyLikelihood idref="dummyLikelihood3"/>
</compoundLikelihood>


<log> element

Logs one or more items at a given frequency to the screen or to a file


The element takes following attributes:

  • Attribute logEvery is Integer
  • Attribute (optional) fileName is String
    The name of the file to send log output to. If no file name is specified then log is sent to standard output
  • Attribute (optional) title is String
    The title of the log


The element has the following contents:

  • At least one of:**Columns elements (one or more)


Example: 

<log logEvery="1" fileName="foo" title="foo">
  <normalPrior idref="normalPrior8"/>
  <binomialLikelihood idref="binomialLikelihood7"/>
</log>


<logisticGrowth> element

Logistic growth demographic model.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
    • Parameter element (exactly one)
      This parameter represents the carrying capacity (maximum population size). If the shape is very large then the current day population size will be very close to the carrying capacity.
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time at peak growth rate.
  • Element named <t50> containing:
    • Parameter element (exactly one)
      This parameter represents the time in the past when the population had half of the carrying capacity (population size). It is therefore a positive number with the same units as divergence times. A scale operator is recommended with a starting value near zero. A lower bound of zero should be employed and an upper bound is required!


Example: 

<logisticGrowth units="substitutions">
 <populationSize>
   <parameter idref="parameter8"/>
 </populationSize>
 <growthRate>
   <parameter idref="parameter7"/>
 </growthRate>
 <t50>
   <parameter idref="parameter2"/>
 </t50>
</logisticGrowth>


<logML> element

Logs one or more items every time the given likelihood improves


The element takes following attributes:

  • Attribute (optional) logEvery is Integer


The element has the following contents:

  • Element named <ml> containing:
  • At least one of:**Columns elements (one or more)


Example: 

<logML logEvery="1">
 <ml>
   <distributionLikelihood idref="distributionLikelihood1"/>
 </ml>
  <distributionLikelihood idref="distributionLikelihood5"/>
  <uniformPrior idref="uniformPrior10"/>
  <test idref="test10"/>
</logML>


<logNormalDistributionModel> element

Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element


The element takes following attributes:

  • Attribute meanInRealSpace is Boolean
  • Attribute (optional) offset is Double


The element has the following contents:

  • Element named <mean> containing:
  • One of:
    • Element named <stdev> containing:
    • Element named <prec> containing:


Example: 

<logNormalDistributionModel meanInRealSpace="true" offset="1.0">
 <mean>
   <parameter idref="parameter1"/>
 </mean>
 <stdev>
   <compoundParameter idref="compoundParameter3"/>
 </stdev>
</logNormalDistributionModel>


<logNormalPrior> element

Calculates the prior probability of some data under a given lognormal distribution.


The element takes following attributes:


The element has the following contents:


Example: 

<logNormalPrior mean="1.0" stdev="1.0" offset="1.0" meanInRealSpace="true">
  <sumStatistic idref="sumStatistic2"/>
  <speciesTreeStatistic idref="speciesTreeStatistic4"/>
  <rateCovarianceStatistic idref="rateCovarianceStatistic10"/>
  <rateStatistic idref="rateStatistic8"/>
</logNormalPrior>


<logTree> element

Logs a tree to a file


The element takes following attributes:

  • Attribute logEvery is Integer
  • Attribute (optional) fileName is String
    The name of the file to send log output to. If no file name is specified then log is sent to standard output
  • Attribute (optional) title is String
    The title of the log
  • Attribute (optional) nexusFormat is Boolean
    Whether to use the NEXUS format for the tree log
  • Attribute (optional) sortTranslationTable is Boolean
    Whether the translation table is sorted.
  • Attribute (optional) branchLengths is String
    What units should the branch lengths be in


The element has the following contents:


Example: 

<!-- The logTree element takes a treeModel to be logged -->
<logTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logTree>


<marginalLikelihoodAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.


The element takes following attributes:

  • Attribute fileName is String
    The name of a BEAST log file (can not include trees, which should be logged separately
  • Attribute (optional) burnIn is Integer


Example: 

<marginalLikelihoodAnalysis fileName="foo" burnIn="1"/>


<mcmc> element

This element returns an MCMC chain and runs the chain as a side effect.


The element takes following attributes:

  • Attribute chainLength is Integer
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) preBurnin is Integer
  • Attribute (optional) temperature is Double
  • Attribute (optional) fullEvaluation is Integer


The element has the following contents:


Example: 

<mcmc chainLength="1" autoOptimize="true" preBurnin="1" temperature="1.0" fullEvaluation="1">
  <operators idref="operators6"/>
  <compoundLikelihood idref="compoundLikelihood5"/>
  <log idref="log6"/>
  <log idref="log5"/>
  <logTree idref="logTree1"/>
  <logML idref="logML1"/>
</mcmc>


<meanStatistic> element

This element returns a statistic that is the mean of the child statistics.


The element has the following contents:


Example: 

<meanStatistic>
  <exp idref="exp7"/>
  <rateStatistic idref="rateStatistic1"/>
  <test idref="test7"/>
  <parameter idref="parameter4"/>
</meanStatistic>


<mergePatterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.


The element has the following contents:


Example: 

<mergePatterns>
  <convert idref="convert4"/>
  <convert idref="convert9"/>
</mergePatterns>


<metaPopulationModel> element

A model that represents a subdivided population.


The element has the following contents:


Example: 

<metaPopulationModel>
  <scaledPiecewisePopulation idref="scaledPiecewisePopulation2"/>
  <twoEpoch idref="twoEpoch7"/>
  <expansion idref="expansion8"/>
</metaPopulationModel>


<mixedDistributionLikelihood> element

Calculates the likelihood of some data given some mix of parametric distributions.


The element has the following contents:


Example: 

<mixedDistributionLikelihood>
 <distribution0>
   <logNormalDistributionModel idref="logNormalDistributionModel10"/>
 </distribution0>
 <distribution1>
   <gammaDistributionModel idref="gammaDistributionModel2"/>
 </distribution1>
 <data>
   <tmrcaStatistic idref="tmrcaStatistic10"/>
 </data>
 <indicators>
   <rateStatistic idref="rateStatistic6"/>
 </indicators>
</mixedDistributionLikelihood>


<monophylyStatistic> element

A statistic that returns true if a given set of taxa are monophyletic for a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic for the purpose of logging


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <mrca> containing:
    • Taxa element (exactly one)


Example: 

<monophylyStatistic name="foo">
  <treeModel idref="treeModel6"/>
 <mrca>
   <taxa idref="taxa6"/>
 </mrca>
</monophylyStatistic>


<mrbayesDefaultModel> element

A speciation model that puts uniform prior on all possible unrooted topologies.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <artificialOutgroup> containing:
    • Taxon element (exactly one)
  • Element named <branchLengthModel> containing:


Example: 

<mrbayesDefaultModel units="days">
 <artificialOutgroup>
   <taxon idref="taxon6"/>
 </artificialOutgroup>
 <branchLengthModel>
   <exponentialDistributionModel idref="exponentialDistributionModel4"/>
 </branchLengthModel>
</mrbayesDefaultModel>


<narrowExchange> element

This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.


The element takes following attributes:


The element has the following contents:


Example: 

<narrowExchange weight="1">
  <treeModel idref="treeModel5"/>
</narrowExchange>


<NDLikelihood> element

This element returns an object that can calculate the likelihood of rate changes in a tree under the assumption of normally distributed rate changes among lineages. Specifically, each branch is assumed to draw a rate from a normal distribution with mean of the rate in the parent branch and the given standard deviation (the variance can be optionally proportional to branch length).


The element takes following attributes:

  • Attribute stdev is Double
    The unit stdev of the model. The variance is scaled by the branch length to get the actual variance in the non-episodic version of the model.
  • Attribute (optional) rootModel is String
    specify the rate model to use at the root. Should be one of: 'meanOfChildren', 'meanOfAll', 'equalToChild', 'ignoreRoot' or 'none'.
  • Attribute episodic is Boolean
    true if model is branch length independent, false if length-dependent.


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The branch rates parameter


Example: 

<NDLikelihood stdev="1.0" rootModel="foo" episodic="true">
  <treeModel idref="treeModel5"/>
 <rates>
   <compoundParameter idref="compoundParameter7"/>
 </rates>
</NDLikelihood>


<negate> element

This element returns a statistic that is the element-wise negation of the child statistic.


The element has the following contents:


Example: 

<negate>
  <test idref="test8"/>
</negate>


<neighborJoiningTree> element

This element returns a neighbour-joining tree generated from the given distances.


The element has the following contents:


Example: 

<neighborJoiningTree>
  <distanceMatrix idref="distanceMatrix6"/>
</neighborJoiningTree>


<newick> element

Constructs a tree from a NEWICK format tree description


The element takes following attributes:

  • Attribute (optional) usingDates is Boolean
  • Attribute (optional) rescaleHeight is Double
    Attempt to rescale the tree to the given root height
  • Attribute (optional) units is String
    The branch length units of this tree


The element has the following contents:

  • String element (exactly one)
    The NEWICK format tree. Tip labels are taken to be Taxon IDs


Example: 

<newick units="years"> ((A:1.0, B:1.0):1.0,(C:2.0, D:2.0):1.0); </newick>


<node> element

This element represents a node in a tree.


The element takes following attributes:

  • Attribute (optional) height is Double
    the age of the node
  • Attribute (optional) rate is Double
    the relative rate of evolution at this node - default is 1.0


The element has the following contents:

  • One of:
    • Taxon element (exactly one)
      The taxon of this leaf node
    • SimpleNode elements (exactly 2)
      The children of this internal node


Example: 

<node height="1.0" rate="1.0">
  <taxon idref="taxon2"/>
</node>


<normalDistributionModel> element

Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element


The element has the following contents:

  • Element named <mean> containing:
  • Element named <stdev> containing:


Example: 

<normalDistributionModel>
 <mean>
   <parameter idref="parameter4"/>
 </mean>
 <stdev>
   1.0
 </stdev>
</normalDistributionModel>


<normalPrior> element

Calculates the prior probability of some data under a given normal distribution.


The element takes following attributes:


The element has the following contents:


Example: 

<normalPrior mean="1.0" stdev="1.0">
  <parsimonyStateStatistic idref="parsimonyStateStatistic9"/>
  <test idref="test8"/>
  <treeLengthStatistic idref="treeLengthStatistic4"/>
</normalPrior>


<operators> element

A simple operator scheduler


The element takes following attributes:

  • Attribute (optional) sequential is Boolean


The element has the following contents:


Example: 

<operators sequential="true">
  <bitFlipOperator idref="bitFlipOperator6"/>
  <centeredScale idref="centeredScale2"/>
</operators>


<optimizer> element

This element returns a maximum likelihood heuristic optimizer and runs the optimization as a side effect.


The element takes following attributes:


The element has the following contents:


Example: 

<optimizer chainLength="1">
  <operators idref="operators3"/>
  <distributionLikelihood idref="distributionLikelihood7"/>
  <log idref="log7"/>
  <log idref="log2"/>
  <logML idref="logML3"/>
  <log idref="log10"/>
</optimizer>


<parameter> element

A real-valued parameter of one or more dimensions.


The element takes following attributes:

  • Attribute (optional) value is Double;
  • Attribute (optional) dimension is Integer
  • Attribute (optional) upper is Double;
  • Attribute (optional) lower is Double;


Example: 

<parameter value="0.5 1.0" dimension="1" upper="0.5 1.0" lower="0.5 1.0"/>


<parsimonyStateStatistic> element

A statistic that has as its value the parsimony state reconstruction of a binary state defined by a set of taxa at a given MRCA of a tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic for the purposes of logging


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <state> containing:
    • Taxa element (exactly one)
  • Element named <mrca> containing:
    • Taxa element (exactly one)


Example: 

<parsimonyStateStatistic name="foo">
  <treeModel idref="treeModel8"/>
 <state>
   <taxa idref="taxa4"/>
 </state>
 <mrca>
   <taxa idref="taxa4"/>
 </mrca>
</parsimonyStateStatistic>


<parsimonyStatistic> element

A statistic that has as its value the parsimony tree length of a set of a binary state defined by a set of taxa for a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <state> containing:
    • Taxa element (exactly one)


Example: 

<parsimonyStatistic name="foo">
  <treeModel idref="treeModel4"/>
 <state>
   <taxa idref="taxa1"/>
 </state>
</parsimonyStatistic>


<patterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.


The element takes following attributes:

  • Attribute (optional) from is Integer
    The site position to start at, default is 1 (the first position)
  • Attribute (optional) to is Integer
    The site position to finish at, must be greater than from, default is length of given alignment
  • Attribute (optional) every is Integer
    Determines how many sites are selected. A value of 3 will select every third site starting from from, default is 1 (every site)


The element has the following contents:

  • Element named <taxonList> containing:
  • Alignment element (exactly one)


Example: 

<patterns from="1" to="1" every="1">
  <convert idref="convert1"/>
</patterns>


<piecewisePopulation> element

This element represents a piecewise population model


The element takes following attributes:


The element has the following contents:

  • Element named <epochSizes> containing:
  • Element named <epochWidths> containing:


Example: 

<piecewisePopulation units="days" linear="true">
 <epochSizes>
   <parameter idref="parameter1"/>
 </epochSizes>
 <epochWidths widths="0.5 1.0"/>
</piecewisePopulation>


<poissonPrior> element

Calculates the prior probability of some data under a given poisson distribution.


The element takes following attributes:


The element has the following contents:


Example: 

<poissonPrior mean="1.0" offset="1.0">
  <statistic idref="statistic4"/>
  <rateStatistic idref="rateStatistic3"/>
  <parsimonyStateStatistic idref="parsimonyStateStatistic5"/>
</poissonPrior>


<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) threads is Integer


The element has the following contents:


Example: 

<compoundLikelihood threads="1">
  <logNormalPrior idref="logNormalPrior10"/>
  <distributionLikelihood idref="distributionLikelihood9"/>
</compoundLikelihood>


<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) threads is Integer


The element has the following contents:


Example: 

<compoundLikelihood threads="1">
  <advancedTreeLikelihood idref="advancedTreeLikelihood5"/>
  <treeLikelihood idref="treeLikelihood5"/>
</compoundLikelihood>


<product> element

This element returns a statistic that is the mean of the child statistics.


The element has the following contents:


Example: 

<product>
  <negate idref="negate6"/>
  <exp idref="exp3"/>
  <varianceStatistic idref="varianceStatistic2"/>
</product>


<property> element

This element returns an object representing the named property of the given child object.


The element takes following attributes:

  • Attribute name is String
    name of the property


The element has the following contents:


Example: 

<property name="length">
  <generalSubstitutionModel idref="generalSubstitutionModel1"/>
</property>


<randomLocalClockModel> element

This element returns an random local clock (RLC) model.Each branch either has a new independent rate or inherits the rate of the branch above it depending on the indicator vector.


The element takes following attributes:

  • Attribute ratesAreMultipliers is Boolean


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rateIndicator> containing:
    • Parameter element (exactly one)
      The rate change indicators parameter
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The rate changes parameter
  • Element named <clockRate> containing:
    • Parameter element (exactly one)
      The mean rate across all local clocks


Example: 

<randomLocalClockModel ratesAreMultipliers="true">
  <treeModel idref="treeModel5"/>
 <rateIndicator>
   <parameter idref="parameter6"/>
 </rateIndicator>
 <rates>
   <compoundParameter idref="compoundParameter6"/>
 </rates>
</randomLocalClockModel>


<randomWalkOperator> element

This element returns a random walk operator on a given parameter.


The element takes following attributes:

  • Attribute windowSize is Double
  • Attribute weight is Integer
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example: 

<randomWalkOperator windowSize="1.0" weight="1" autoOptimize="true">
  <parameter idref="parameter1"/>
</randomWalkOperator>


<rateCovarianceStatistic> element

A statistic that has as its value the covariance of parent and child branch rates


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:


Example: 

<rateCovarianceStatistic name="foo">
  <treeModel idref="treeModel2"/>
  <randomLocalClockModel idref="randomLocalClockModel2"/>
</rateCovarianceStatistic>


<rateEpochBranchRates> element

This element provides a multiple epoch molecular clock model. All branches (or portions of them) have the same rate of molecular evolution within a given epoch.


The element has the following contents:

  • Element named <epoch> containing:
    • Attribute transitionTime is Double
      The time of transition between this epoch and the previous one
    • Parameter element (exactly one)
      The evolutionary rate parameter for this epoch
      An epoch that lasts until transitionTime
  • Element named <rate> containing:
    • Parameter element (exactly one)
      The ancestral molecular evolutionary rate parameter


Example: 

<rateEpochBranchRates>
 <epoch transitionTime="1.0">
   <compoundParameter idref="compoundParameter2"/>
 </epoch>
 <epoch transitionTime="1.0">
   <compoundParameter idref="compoundParameter8"/>
 </epoch>
 <rate>
   <parameter idref="parameter6"/>
 </rate>
</rateEpochBranchRates>


<rateExchange> element

An operator that exchanges rates and traits on a tree.


The element takes following attributes:


The element has the following contents:


Example: 

<rateExchange weight="1" swapRates="true" swapTraits="true" swapAtRoot="true" moveHeight="true">
  <treeModel idref="treeModel8"/>
</rateExchange>


<rateStatistic> element

A statistic that returns the average of the branch rates


The element takes following attributes:

  • Attribute internal is Boolean
  • Attribute external is Boolean
  • Attribute mode is String
    This attribute determines how the rates are summarized, can be one of (mean, variance, coefficientOfVariance)
  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:


Example: 

<rateStatistic internal="true" external="true" mode="variance" name="foo">
  <treeModel idref="treeModel6"/>
  <GDLikelihood idref="GDLikelihood1"/>
</rateStatistic>


<reciprocal> element

This element returns a statistic that is the element-wise reciprocal of the child statistic.


The element has the following contents:


Example: 

<reciprocal>
  <treeMetricStatistic idref="treeMetricStatistic5"/>
</reciprocal>


<report> element

Generates a report using the given text and elements


The element takes following attributes:

  • Attribute (optional) type is String
    The format of the report
  • Attribute (optional) title is String
    The title of the report


The element has the following contents:

  • Object elements (one or more)
    An arbitrary mixture of text and elements to report


Example: 

<report type="XHTML" title="Report">
  <sequence idref="sequence8"/>
</report>


<scaledPiecewisePopulation> element

This element represents a piecewise population model


The element takes following attributes:


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <populationTree> containing:


Example: 

<scaledPiecewisePopulation units="years" linear="true">
 <populationSizes>
   <compoundParameter idref="compoundParameter3"/>
 </populationSizes>
 <populationTree>
   <treeModel idref="treeModel8"/>
 </populationTree>
</scaledPiecewisePopulation>


<scaleOperator> element

This element returns a scale operator on a given parameter.


The element takes following attributes:

  • Attribute scaleFactor is Double
  • Attribute (optional) scaleAll is Boolean
  • Attribute weight is Integer
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) pickoneprob is Double


The element has the following contents:


Example: 

<scaleOperator scaleFactor="1.0" scaleAll="true" weight="1" autoOptimize="true" pickoneprob="1.0">
  <parameter idref="parameter7"/>
</scaleOperator>


<sequence> element

A biomolecular sequence.


The element has the following contents:

  • Taxon element (exactly one)
  • String element (exactly one)
    A character string representing the aligned molecular sequence


Example: 

<sequence>
  <taxon idref="taxon7"/>
  ACGACTAGCATCGAGCTTCG--GATAGCATGC
</sequence>


<setOperator> element

This element represents an operator on a set.


The element takes following attributes:


The element has the following contents:


Example: 

<setOperator set="0.5 1.0">
  <parameter idref="parameter8"/>
</setOperator>


<siteModel> element

A SiteModel that has a gamma distributed rates across sites


The element has the following contents:

  • Element named <substitutionModel> containing:
  • One of:
    • Element named <mutationRate> containing:
    • Element named <relativeRate> containing:
  • Element named <gammaShape> containing:
    • Attribute (optional) gammaCategories is Integer
    • Parameter element (exactly one)
  • Element named <proportionInvariant> containing:


Example: 

<siteModel>
 <substitutionModel>
   <yangCodonModel idref="yangCodonModel1"/>
 </substitutionModel>
 <relativeRate>
   <parameter idref="parameter8"/>
 </relativeRate>
</siteModel>


<skyLineLikelihood> element

This element represents the likelihood of the tree given the population size vector.


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <populationTree> containing:


Example: 

<skyLineLikelihood>
 <populationSizes>
   <parameter idref="parameter4"/>
 </populationSizes>
 <populationTree>
   <treeModel idref="treeModel2"/>
 </populationTree>
</skyLineLikelihood>


<speciationLikelihood> element

This element represents the likelihood of the tree given the speciation.


The element has the following contents:

  • Element named <model> containing:
  • Element named <speciesTree> containing:


Example: 

<speciationLikelihood>
 <model>
   <yuleModel idref="yuleModel6"/>
 </model>
 <speciesTree>
   <treeModel idref="treeModel9"/>
 </speciesTree>
</speciationLikelihood>


<speciesTreeStatistic> element

A statistic that returns true if the given population tree is compatible with the species tree. Compatibility is defined as the compatibility of the timings of the events, so that incompatibility arises if two individuals in the population tree coalescent before their species do in the species tree.


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:

  • Element named <speciesTree> containing:
    • Tree element (exactly one)
  • Element named <populationTree> containing:
    • Tree element (exactly one)


Example: 

<speciesTreeStatistic name="foo">
 <speciesTree>
   <treeModel idref="treeModel10"/>
 </speciesTree>
 <populationTree>
   <treeModel idref="treeModel1"/>
 </populationTree>
</speciesTreeStatistic>


<statistic> element

A statistic of a given name from the specified object.


The element takes following attributes:

  • Attribute name is String
    The name of the statistic you wish to extract from the given object


The element has the following contents:


Example: 

<statistic name="foo">
  <gammaDistributionModel idref="gammaDistributionModel9"/>
</statistic>


<strictClockBranchRates> element

This element provides a strict clock model. All branches have the same rate of molecular evolution.


The element has the following contents:

  • Element named <rate> containing:
    • Parameter element (exactly one)
      The molecular evolutionary rate parameter


Example: 

<strictClockBranchRates>
 <rate>
   <parameter idref="parameter2"/>
 </rate>
</strictClockBranchRates>


<string> element

returns a String. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned.


The element has the following contents:

  • One of:
    • Attribute prompt is String
      A message displayed to the user when entering a value for this string
    • String element (exactly one)


Example: 

<string prompt="Enter the name of a dinosaur:"/>


<structuredCoalescentLikelihood> element

This element represents a likelihood function for transmission.


The element has the following contents:


Example: 

<structuredCoalescentLikelihood>
  <treeModel idref="treeModel7"/>
  ERROR!
  <constantMigrationModel idref="constantMigrationModel4"/>
  <metaPopulationModel idref="metaPopulationModel3"/>
</structuredCoalescentLikelihood>


<subtreeSlide> element

An operator that slides a subtree.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute size is Double
  • Attribute gaussian is Boolean
  • Attribute (optional) swapInRandomRate is Boolean
  • Attribute (optional) swapInRandomTrait is Boolean
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example: 

<subtreeSlide weight="1" size="1.0" gaussian="true" swapInRandomRate="true" swapInRandomTrait="true" autoOptimize="true">
  <treeModel idref="treeModel2"/>
</subtreeSlide>


<sumStatistic> element

This element returns a statistic that is the element-wise sum of the child statistics.


The element takes following attributes:


The element has the following contents:


Example: 

<sumStatistic elementwise="true">
  <monophylyStatistic idref="monophylyStatistic2"/>
  <sumStatistic idref="sumStatistic1"/>
  <statistic idref="statistic6"/>
  <rateStatistic idref="rateStatistic8"/>
</sumStatistic>


<swapOperator> element

This element represents an operator that swaps values in a multi-dimensional parameter.


The element takes following attributes:


The element has the following contents:


Example: 

<swapOperator weight="1" size="1" autoOptimize="true">
  <compoundParameter idref="compoundParameter2"/>
</swapOperator>


<taxa> element

Defines a set of taxon objects.


The element has the following contents:

  • At least one of:**Taxa elements (one or more)
    • Taxon elements (one or more)


Example: 

<!-- A list of six taxa -->
<taxa id="greatApes">
	<taxon id="human"/>
	<taxon id="chimp"/>
	<taxon id="bonobo"/>
	<taxon id="gorilla"/>
	<taxon id="orangutan"/>
	<taxon id="siamang"/>
</taxa>

<!-- A list of three taxa by references to above taxon objects -->
<taxa id="humanAndChimps">
	<taxon idref="human"/>
	<taxon idref="chimp"/>
	<taxon idref="bonobo"/>
</taxa>


<taxon> element

The element takes following attributes:

  • Attribute id is String
    A unique identifier for this taxon


The element has the following contents:

  • Date element (zero or one)


Example: 

<taxon id="foo"/>


<test> element

This element represents a boolean statistic that returns 1 if the conditions are met and 0 otherwise.


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic, for logging purposes


The element has the following contents:

  • Attribute element (exactly one)
  • One of:
    • Element named <equals> containing:
    • Element named <greaterThan> containing:
    • Element named <lessThan> containing:
    • Attribute equals is Double
    • Attribute greaterThan is Double
    • Attribute lessThan is Double
    • Attribute inside is Double;
    • Attribute outside is Double;


Example: 

<test name="foo" lessThan="1.0">
  <statistic idref="statistic1"/>
</test>


<tipHeightLikelihood> element

Calculates the likelihood of the tipHeights given some parametric or empirical distribution.


The element has the following contents:


Example: 

<tipHeightLikelihood>
 <distribution>
   <exponentialDistributionModel idref="exponentialDistributionModel6"/>
 </distribution>
 <tipHeights>
   <parameter idref="parameter2"/>
 </tipHeights>
</tipHeightLikelihood>


<tkf91Likelihood> element

Returns the total likelihood of a single alignment under the TKF91 model, for a given tree. In particular all possible ancestral histories of insertions and deletions leading to the alignment of sequences at the tips are taken into account.


The element has the following contents:


Example: 

<tkf91Likelihood>
  <treeModel idref="treeModel6"/>
  <convert idref="convert9"/>
  <siteModel idref="siteModel10"/>
  <tkf91Model idref="tkf91Model9"/>
</tkf91Likelihood>


<tkf91Model> element

The TKF91 (Thorne, Kishino & Felsenstein 1991) model of insertion-deletion.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <lengthDistribution> containing:
  • Element named <deathRate> containing:


Example: 

<tkf91Model units="generations">
 <lengthDistribution>
   <compoundParameter idref="compoundParameter4"/>
 </lengthDistribution>
 <deathRate>
   <compoundParameter idref="compoundParameter5"/>
 </deathRate>
</tkf91Model>


<tmrcaStatistic> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging
  • Attribute (optional) rate is Boolean


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <mrca> containing:
    • Taxa element (exactly one)


Example: 

<tmrcaStatistic name="foo" rate="true">
  <treeModel idref="treeModel4"/>
 <mrca>
   <taxa idref="taxa8"/>
 </mrca>
</tmrcaStatistic>


<traceAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.


The element takes following attributes:

  • Attribute fileName is String
    The name of a BEAST log file (can not include trees, which should be logged separately
  • Attribute (optional) burnIn is Integer


Example: 

<traceAnalysis fileName="foo" burnIn="1"/>


<tree> element

This element represents a rooted binary tree and associated attributes.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:


Example: 

<tree units="generations">
  <node idref="node10"/>
</tree>


<treeColouringOperator> element

A tree colouring model.


The element has the following contents:


Example: 

<treeColouringOperator>
  ERROR!
</treeColouringOperator>


<treeLengthStatistic> element

A statistic that returns the average of the branch rates


The element has the following contents:


Example: 

<treeLengthStatistic>
  <treeModel idref="treeModel5"/>
</treeLengthStatistic>


<treeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) storePartials is Boolean
  • Attribute (optional) useScaling is Boolean


The element has the following contents:


Example: 

<treeLikelihood useAmbiguities="true" storePartials="true" useScaling="true">
  <mergePatterns idref="mergePatterns3"/>
  <treeModel idref="treeModel8"/>
  <siteModel idref="siteModel5"/>
</treeLikelihood>


<treeMetricStatistic> element

A statistic that returns the distance between two trees. with method="topology", return a 0 for identity and a 1 for difference. With other methods return the distance metric associated with that method.


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging
  • Attribute (optional) method is String
    comparision method (TOPOLOGY,BILLERA,ROBINSONSFOULD,CLADEHEIGHTM)


The element has the following contents:

  • Element named <target> containing:
  • Element named <reference> containing:
    • Tree element (exactly one)


Example: 

<treeMetricStatistic name="foo" method="foo">
 <target>
   <treeModel idref="treeModel1"/>
 </target>
 <reference>
   <neighborJoiningTree idref="neighborJoiningTree4"/>
 </reference>
</treeMetricStatistic>


<treeModel> element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.


The element has the following contents:

  • Tree element (exactly one)
  • Element named <rootHeight> containing:
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)
  • Element named <nodeHeights> containing:
    • Attribute (optional) rootNode is Boolean
      If true the root height is included in the parameter
    • Attribute (optional) internalNodes is Boolean
      If true the internal node heights (minus the root) are included in the parameter
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)


Example: 

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>


<treeShapeStatistics> element

A statistic that reports a handful of tree shape statistics on the given target tree.


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:

  • Element named <target> containing:


Example: 

<treeShapeStatistics name="foo">
 <target>
   <treeModel idref="treeModel1"/>
 </target>
</treeShapeStatistics>


<treeTraceAnalysis> element

Analyses and reports on a trace consisting of trees.


The element takes following attributes:

  • Attribute fileName is String
    name of a tree log file
  • Attribute (optional) burnIn is Integer


Example: 

<treeTraceAnalysis fileName="trees.log" burnIn="1"/>


<twoEpoch> element

A demographic model of two epochs.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <modernEpoch> containing:
    • DemographicModel element (exactly one)
      The demographic model for the recent epoch.
  • Element named <ancientEpoch> containing:
    • DemographicModel element (exactly one)
      The demographic model for the ancient epoch.
  • Element named <transitionTime> containing:
    • Parameter element (exactly one)
      The time that splits the two epochs.


Example: 

<twoEpoch units="years">
 <modernEpoch>
   <constantExponential idref="constantExponential4"/>
 </modernEpoch>
 <ancientEpoch>
   <constantSize idref="constantSize9"/>
 </ancientEpoch>
 <transitionTime>
   <parameter idref="parameter10"/>
 </transitionTime>
</twoEpoch>


<uniformDistributionModel> element

Describes a uniform distribution with a given lower and upper bounds


The element has the following contents:

  • Element named <lower> containing:
  • Element named <upper> containing:


Example: 

<uniformDistributionModel>
 <lower>
   1.0
 </lower>
 <upper>
   1.0
 </upper>
</uniformDistributionModel>


<uniformOperator> element

An operator that picks new parameter values uniformly at random.


The element takes following attributes:


The element has the following contents:


Example: 

<uniformOperator weight="1">
  <parameter idref="parameter9"/>
</uniformOperator>


<uniformPrior> element

Calculates the prior probability of some data under a given uniform distribution.


The element takes following attributes:


The element has the following contents:


Example: 

<uniformPrior lower="1.0" upper="1.0">
  <treeShapeStatistics idref="treeShapeStatistics10"/>
</uniformPrior>


<uniformRootPrior> element

This element represents the likelihood of the tree given the demographic function.


The element takes following attributes:

  • Attribute maxRootHeight is Double


The element has the following contents:


Example: 

<uniformRootPrior maxRootHeight="1.0">
  <treeModel idref="treeModel4"/>
</uniformRootPrior>


<upDownOperator> element

This element represents an operator that scales two parameters in different directions. Each operation involves selecting a scale uniformly at random between scaleFactor and 1/scaleFactor. The up parameter is multipled by this scale and the down parameter is divided by this scale.


The element takes following attributes:

  • Attribute scaleFactor is Double
  • Attribute weight is Integer
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:

  • Element named <up> containing:
  • Element named <down> containing:


Example: 

<upDownOperator scaleFactor="1.0" weight="1" autoOptimize="true">
 <up>
   <parameter idref="parameter6"/>
 </up>
 <down>
   <compoundParameter idref="compoundParameter5"/>
 </down>
</upDownOperator>


<upgmaTree> element

This element returns a UPGMA tree generated from the given distances.


The element takes following attributes:

  • Attribute (optional) usingDates is Boolean
  • Attribute (optional) rootHeight is Double


The element has the following contents:


Example: 

<upgmaTree usingDates="true" rootHeight="1.0">
  <distanceMatrix idref="distanceMatrix8"/>
</upgmaTree>


<varianceStatistic> element

This element returns a statistic that is the variance of the child statistics.


The element has the following contents:


Example: 

<varianceStatistic>
  <reciprocal idref="reciprocal9"/>
</varianceStatistic>


<wideExchange> element

This element represents a wide exchange operator. This operator swaps two random subtrees.


The element takes following attributes:


The element has the following contents:


Example: 

<wideExchange weight="1">
  <treeModel idref="treeModel9"/>
</wideExchange>


<wilsonBalding> element

An operator which performs the Wilson-Balding move on a tree


The element takes following attributes:


The element has the following contents:


Example: 

<wilsonBalding weight="1">
  <treeModel idref="treeModel6"/>
</wilsonBalding>


<yangCodonModel> element

This element represents the Yang model of codon evolution.


The element takes following attributes:

  • Attribute (optional) geneticCode is String
    The genetic code to use


The element has the following contents:

  • Element named <omega> containing:
  • Element named <kappa> containing:
  • FrequencyModel element (exactly one)


Example: 

<yangCodonModel geneticCode="yeast">
 <omega>
   <compoundParameter idref="compoundParameter6"/>
 </omega>
 <kappa>
   <parameter idref="parameter3"/>
 </kappa>
  <frequencyModel idref="frequencyModel8"/>
</yangCodonModel>


<yuleModel> element

A speciation model of a Yule process.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <birthRate> containing:


Example: 

<yuleModel units="months">
 <birthRate>
   <parameter idref="parameter5"/>
 </birthRate>
</yuleModel>


BEAST types

The following is a list of generic types that elements represent in a beast file.

Alignment

Elements of this type include:

Attribute

Elements of this type include:

BayesianSkylineLikelihood

Elements of this type include:


Boolean

Elements of this type include:


BooleanStatistic

Elements of this type include:

BranchAttributeProvider

Elements of this type include:

BranchRateController

Elements of this type include:

BranchRateModel

Elements of this type include:

BranchingModel

Elements of this type include:

ColourSamplerModel

Elements of this type include:


Columns

Elements of this type include:

ConstantPopulationModel

Elements of this type include:

DataType

Elements of this type include:

Date

Elements of this type include:

DemographicModel

Elements of this type include:

DistanceMatrix

Elements of this type include:

Double

Elements of this type include:

Double;

Elements of this type include:


ExponentialGrowthModel

Elements of this type include:

FrequencyModel

Elements of this type include:

GammaSiteModel

Elements of this type include:

Integer

Elements of this type include:

Integer;

Elements of this type include:


Likelihood

Elements of this type include:

Loggable

Elements of this type include:

Logger

Elements of this type include:

MCMCOperator

Elements of this type include:

MetaPopulationModel

Elements of this type include:

MigrationModel

Elements of this type include:

Model

Elements of this type include:

NodeAttributeProvider

Elements of this type include:

OperatorSchedule

Elements of this type include:

Parameter

Elements of this type include:

ParametricDistributionModel

Elements of this type include:

PatternList

Elements of this type include:

Sequence

Elements of this type include:

SimpleNode

Elements of this type include:

SiteList

Elements of this type include:

SiteModel

Elements of this type include:

SpeciationModel

Elements of this type include:

Statistic

Elements of this type include:

StatisticList

Elements of this type include:

String

Elements of this type include:

String;

Elements of this type include:


SubstitutionModel

Elements of this type include:

TKF91Likelihood

Elements of this type include:

TKF91Model

Elements of this type include:

Taxa

Elements of this type include:

Taxon

Elements of this type include:

TaxonList

Elements of this type include:

Tree

Elements of this type include:

TreeAttributeProvider

Elements of this type include:


TreeColouringProvider

Elements of this type include:


TreeModel

Elements of this type include:

Return to contents

Alexei Drummond and Andrew Rambaut
Copyright © 2002-2006 All rights reserved.

Retrieved from "http://beast.bio.ed.ac.uk/BEAST_XML_Reference"
Personal tools