BEAST v1.6.x XML Reference
From BEAST Software
BEAST Documentation-> BEAST v1.6.x XML Reference
BEAST v1.6.0 Parser Library (2002-2010)
Release Version (updated on 17 September 2010 NZST)
The following is a list of valid elements in a beast file.
<ACLikelihood> element
This element returns an object that can calculate the likelihood of rate changes in a tree under the assumption of distributed rate changes among lineages. Specifically, each branch is assumed to draw a rate from a distribution with mean of the rate in the parent branch and the given standard deviation (the variance can be optionally proportional to branch length).
The element takes following attributes:
- Attribute
episodicis Boolean- true if model is branch length independent, false if length-dependent.
- Attribute
distributionis String- The distribution to use
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- The branch rates parameter
- Parameter element (exactly one)
- Element named
<rootRate>containing:- Parameter element (exactly one)
- The root rate parameter
- Parameter element (exactly one)
- Element named
<variance>containing:- Parameter element (exactly one)
- The standard deviation of the distribution
- Parameter element (exactly one)
Example:
<ACLikelihood episodic="true" distribution="foo"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel4"/> <rates> <matrixParameter idref="matrixParameter4"/> </rates> <rootRate> <maskedParameter idref="maskedParameter10"/> </rootRate> <variance> <matrixParameter idref="matrixParameter5"/> </variance> </ACLikelihood>
<addremoveARGEvent> element
An operator that slides a subarg.
The element takes following attributes:
- Attribute
weightis Integer - Attribute
sizeis Double - Attribute
gaussianis Boolean - Attribute (optional)
swapRatesis Boolean - Attribute (optional)
swapTraitsis Boolean - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- ARGModel element (exactly one)
Example:
<addremoveARGEvent weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true"> <argTreeModel idref="argTreeModel9"/> </addremoveARGEvent>
<alignment> element
This element represents an alignment of molecular sequences.
The element has the following contents:
- Sequence elements (one or more)
Example:
<!-- An alignment of three short DNA sequences -->
<alignment missing="-?" dataType="nucleotide">
<sequence>
<taxon idref="taxon1"/>
ACGACTAGCATCGAGCTTCG--GATAGCAGGC
</sequence>
<sequence>
<taxon idref="taxon2"/>
ACGACTAGCATCGAGCTTCGG-GATAGCATGC
</sequence>
<sequence>
<taxon idref="taxon3"/>
ACG?CTAGAATCGAGCTTCGAGGATAGCATGC
</sequence>
</alignment>
<alignmentChunkOperator> element
This element represents an operator that re-aligns a small chunk of an alignment.
The element takes following attributes:
- Attribute
weightis Double - Attribute
iPis Double- tuning probability, values near zero resamples entire alignment and near 1.0 resamples single columns.
- Attribute
exponentis Double- tuning parameter, value of 1.0 samples random alignments, large values (e.g. 2.7) sample alignment peaked around 'best' alignment
- Attribute
gapPenaltyis Double- tuning parameter, must be negative, large values penalize gaps more in the alignment proposal.
The element has the following contents:
- TKF91Likelihood element (exactly one)
Example:
<alignmentChunkOperator weight="1.0" iP="1.0" exponent="1.0" gapPenalty="1.0"> <tkf91Likelihood idref="tkf91Likelihood2"/> </alignmentChunkOperator>
<alsTreeLikelihood> element
This element represents the likelihood of a patternlist on a tree given the site model.
The element takes following attributes:
- Attribute (optional)
useAmbiguitiesis Boolean - Attribute (optional)
storePartialsis Boolean - Attribute
integrateGainRateis Boolean
The element has the following contents:
- Element named
<immigrationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- PatternList element (exactly one)
- TreeModel element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (zero or one)
- Element named
<observationProcess>containing:
Example:
<alsTreeLikelihood useAmbiguities="true" storePartials="true" integrateGainRate="true"> <convert idref="convert1"/> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel9"/> <categorySiteModel idref="categorySiteModel5"/> <observationProcess type="foo" taxon="foo"/> </alsTreeLikelihood>
<aminoAcidModel> element
An empirical amino acid substitution model.
The element takes following attributes:
- Attribute
typeis String- The type of empirical amino-acid rate matrix
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- If the frequencies are omitted than the empirical frequencies associated with the selected model are used.
- FrequencyModel element (exactly one)
Example:
<aminoAcidModel type="WAG"/>
<ancestralTrait> element
A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
- Attribute (optional)
traitNameis String- The name of the trait to log
The element has the following contents:
- TreeModel element (exactly one)
- TreeTraitProvider element (exactly one)
- Element named
<mrca>containing:- Taxa element (exactly one)
- Taxa element (exactly one)
Example:
<ancestralTrait name="foo" traitName="foo"> <treeModel idref="treeModel3"/> <multivariateTraitLikelihood idref="multivariateTraitLikelihood1"/> <mrca> <taxa idref="taxa10"/> </mrca> </ancestralTrait>
<ancestralTrait> element
A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
- Attribute (optional)
traitNameis String- The name of the trait to log
The element has the following contents:
- TreeModel element (exactly one)
- TreeTraitProvider element (exactly one)
- Element named
<mrca>containing:- Taxa element (exactly one)
- Taxa element (exactly one)
Example:
<ancestralTrait name="foo" traitName="foo"> <treeModel idref="treeModel6"/> <ancestralTreeLikelihood idref="ancestralTreeLikelihood5"/> <mrca> <taxa idref="taxa1"/> </mrca> </ancestralTrait>
<ancestralTreeLikelihood> element
This element represents the likelihood of a patternlist on a tree given the site model.
The element takes following attributes:
- Attribute (optional)
useAmbiguitiesis Boolean - Attribute (optional)
storePartialsis Boolean - Attribute (optional)
tagNameis String - Attribute (optional)
forceRescalingis Boolean - Attribute (optional)
useMAPis Boolean - Attribute (optional)
useMarginalLikelihoodis Boolean
The element has the following contents:
- PatternList element (exactly one)
- TreeModel element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (zero or one)
- SubstitutionModel element (exactly one)
Example:
<ancestralTreeLikelihood useAmbiguities="true" storePartials="true" tagName="foo" forceRescaling="true" useMAP="true" useMarginalLikelihood="true"> <convert idref="convert5"/> <treeModel idref="treeModel10"/> <sampleStateAndCategoryModel idref="sampleStateAndCategoryModel6"/> <TWOPHASEModel idref="TWOPHASEModel2"/> </ancestralTreeLikelihood>
<anyTipObservationProcess> element
This element represents an instance of the AnyTipObservationProcess for ALSTreeLikelihood calculations
The element has the following contents:
- TreeModel element (exactly one)
- PatternList element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (exactly one)
- Element named
<deathRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<immigrationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<anyTipObservationProcess> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3"/> <patterns idref="patterns1"/> <sampleStateAndCategoryModel idref="sampleStateAndCategoryModel3"/> <scaledTreeLengthModel idref="scaledTreeLengthModel1"/> <deathRate> <duplicatedParameter idref="duplicatedParameter6"/> </deathRate> <immigrationRate> <matrixParameter idref="matrixParameter3"/> </immigrationRate> </anyTipObservationProcess>
<arbitraryBranchRates> element
This element returns an arbitrary rate model.The branch rates are drawn from an arbitrary distribution determine by the prior.
The element takes following attributes:
- Attribute (optional)
reciprocalis Boolean
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- The rate parameter
- Parameter element (exactly one)
Example:
<arbitraryBranchRates reciprocal="true"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2"/> <rates> <designMatrix idref="designMatrix1"/> </rates> </arbitraryBranchRates>
<argCoalescentLikelihood> element
A coalescent likelihood for an ARG model
The element takes following attributes:
- Attribute (optional)
ancestralRestrictionis Boolean
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<recombinationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<argModel>containing:- ARGModel element (exactly one)
- ARGModel element (exactly one)
Example:
<argCoalescentLikelihood ancestralRestriction="true"> <populationSize> <diagonalMatrix idref="diagonalMatrix9"/> </populationSize> <recombinationRate> <compoundParameter idref="compoundParameter7"/> </recombinationRate> <argModel> <argTreeModel idref="argTreeModel3"/> </argModel> </argCoalescentLikelihood>
<argDiscretizedBranchRates> element
This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.
The element takes following attributes:
- Attribute
numRateCategoriesis Integer
The element has the following contents:
- ARGModel element (exactly one)
- Element named
<distribution>containing:- ParametricDistributionModel element (exactly one)
- The distribution model for rates among branches
- ParametricDistributionModel element (exactly one)
Example:
<argDiscretizedBranchRates numRateCategories="1"> <argTreeModel idref="argTreeModel6"/> <distribution> <onePGammaDistributionModel idref="onePGammaDistributionModel3"/> </distribution> </argDiscretizedBranchRates>
<ARGEventOperator> element
An operator that slides a subarg.
The element takes following attributes:
- Attribute
addProbabilityis Double- The probability that the operator adds a new reassortment event
- Attribute (optional)
jointPartitioningis Boolean - Attribute (optional)
tossSizeis Integer - Attribute (optional)
addProbabilityis Double - Attribute (optional)
autoOptimizeis Boolean - Attribute
weightis Integer
The element has the following contents:
- ARGModel element (exactly one)
- ARGPartitionLikelihood element (exactly one)
- ARGRatePrior element (zero or one)
- Element named
<internalNodes>containing:- CompoundParameter element (exactly one)
- CompoundParameter element (exactly one)
- Element named
<internalNodesPlusRoot>containing:- CompoundParameter element (exactly one)
- CompoundParameter element (exactly one)
- Element named
<nodeRates>containing:- CompoundParameter element (exactly one)
- CompoundParameter element (exactly one)
Example:
<ARGEventOperator addProbability="1.0" jointPartitioning="true" tossSize="1" addProbability="1.0" autoOptimize="true" weight="1"> <argTreeModel idref="argTreeModel1"/> <poissonPartitionLikelihood idref="poissonPartitionLikelihood6"/> <internalNodes> <matrixParameter idref="matrixParameter7"/> </internalNodes> <internalNodesPlusRoot> <matrixParameter idref="matrixParameter9"/> </internalNodesPlusRoot> <nodeRates> <diagonalMatrix idref="diagonalMatrix10"/> </nodeRates> </ARGEventOperator>
<argLocalClock> element
null
Example:
<argLocalClock/>
<argTreeModel> element
This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.
The element takes following attributes:
- Attribute (optional)
partitionTypeis String- Describes the partition structure of the model
The element has the following contents:
- Tree element (exactly one)
- Element named
<rootHeight>containing:- Parameter element (exactly one)
- A parameter definition with id only (cannot be a reference!)
- Parameter element (exactly one)
- Element named
<nodeHeights>containing:- Attribute (optional)
rootNodeis Boolean- If true the root height is included in the parameter
- Attribute (optional)
internalNodesis Boolean- If true the internal node heights (minus the root) are included in the parameter
- Parameter element (exactly one)
- A parameter definition with id only (cannot be a reference!)
- Attribute (optional)
Example:
<!-- the tree model as special sockets for attaching parameters to various aspects of the tree --> <!-- The treeModel below shows the standard setup with a parameter associated with the root height --> <!-- a parameter associated with the internal node heights (minus the root height) and --> <!-- a parameter associates with all the internal node heights --> <!-- Notice that these parameters are overlapping --> <!-- The parameters are subsequently used in operators to propose changes to the tree node heights --> <treeModel id="treeModel1"> <tree idref="startingTree"/> <rootHeight> <parameter id="treeModel1.rootHeight"/> </rootHeight> <nodeHeights internalNodes="true" rootNode="false"> <parameter id="treeModel1.internalNodeHeights"/> </nodeHeights> <nodeHeights internalNodes="true" rootNode="true"> <parameter id="treeModel1.allInternalNodeHeights"/> </nodeHeights> </treeModel>
<argNarrowExchange> element
This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.
The element takes following attributes:
- Attribute
weightis Integer
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argNarrowExchange weight="1"> <argTreeModel idref="argTreeModel3"/> </argNarrowExchange>
<argPartitionOperator> element
An operator that picks a new partitioning uniformly at random.
The element takes following attributes:
- Attribute
weightis Integer - Attribute (optional)
tossSizeis Integer - Attribute (optional)
tossAllis Boolean
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argPartitionOperator weight="1" tossSize="1" tossAll="true"> <argTreeModel idref="argTreeModel8"/> </argPartitionOperator>
<argRatePrior> element
null
Example:
<argRatePrior/>
<argReassortmentNodeCount> element
A statistic that returns the number of reassortment nodes in an ARG
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic for the purpose of logging
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argReassortmentNodeCount name="foo"> <argTreeModel idref="argTreeModel8"/> </argReassortmentNodeCount>
<argSubtreeSlide> element
An operator that slides a subtree.
The element takes following attributes:
- Attribute
weightis Integer - Attribute
sizeis Double - Attribute
gaussianis Boolean - Attribute (optional)
swapRatesis Boolean - Attribute (optional)
swapTraitsis Boolean - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argSubtreeSlide weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true"> <argTreeModel idref="argTreeModel9"/> </argSubtreeSlide>
<argSwapOperator> element
Swaps nodes on a tree
The element takes following attributes:
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argSwapOperator weight="1" type="bifurcationSwap"> <argTreeModel idref="argTreeModel1"/> </argSwapOperator>
<argTimingStatistic> element
The element takes following attributes:
- Attribute (optional)
nameis String
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argTimingStatistic name="foo"> <argTreeModel idref="argTreeModel9"/> </argTimingStatistic>
<argTotalLengthStatistic> element
null
Example:
<argTotalLengthStatistic/>
<argTraceAnalysis> element
Analyses and reports on a trace consisting of trees.
The element takes following attributes:
Example:
<argTraceAnalysis fileName="trees.log" burnIn="1"/>
<argTreeCount> element
Provides number of distinct loci trees
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argTreeCount> <argTreeModel idref="argTreeModel9"/> </argTreeCount>
<argTreeLikelihood> element
This element represents the likelihood of a patternlist on a tree given the site model.
The element takes following attributes:
- Attribute (optional)
useAmbiguitiesis Boolean - Attribute (optional)
storePartialsis Boolean - Attribute (optional)
useScalingis Boolean
The element has the following contents:
- PatternList element (exactly one)
- ARGModel element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (zero or one)
Example:
<argTreeLikelihood useAmbiguities="true" storePartials="true" useScaling="true"> <convert idref="convert3"/> <argTreeModel idref="argTreeModel2"/> <categorySiteModel idref="categorySiteModel7"/> </argTreeLikelihood>
<argTreeModel> element
This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.
The element takes following attributes:
- Attribute (optional)
partitionTypeis String- Describes the partition structure of the model
The element has the following contents:
- Tree element (exactly one)
- Element named
<rootHeight>containing:- Parameter element (exactly one)
- A parameter definition with id only (cannot be a reference!)
- Parameter element (exactly one)
- Element named
<nodeHeights>containing:- Attribute (optional)
rootNodeis Boolean- If true the root height is included in the parameter
- Attribute (optional)
internalNodesis Boolean- If true the internal node heights (minus the root) are included in the parameter
- Parameter element (exactly one)
- A parameter definition with id only (cannot be a reference!)
- Attribute (optional)
Example:
<!-- the tree model as special sockets for attaching parameters to various aspects of the tree --> <!-- The treeModel below shows the standard setup with a parameter associated with the root height --> <!-- a parameter associated with the internal node heights (minus the root height) and --> <!-- a parameter associates with all the internal node heights --> <!-- Notice that these parameters are overlapping --> <!-- The parameters are subsequently used in operators to propose changes to the tree node heights --> <treeModel id="treeModel1"> <tree idref="startingTree"/> <rootHeight> <parameter id="treeModel1.rootHeight"/> </rootHeight> <nodeHeights internalNodes="true" rootNode="false"> <parameter id="treeModel1.internalNodeHeights"/> </nodeHeights> <nodeHeights internalNodes="true" rootNode="true"> <parameter id="treeModel1.allInternalNodeHeights"/> </nodeHeights> </treeModel>
<argUniformPrior> element
A uniform prior for an ARG model
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argUniformPrior> <argTreeModel idref="argTreeModel5"/> </argUniformPrior>
<argWideExchange> element
This element represents a wide exchange operator. This operator swaps two random subtrees.
The element takes following attributes:
- Attribute
weightis Integer
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argWideExchange weight="1"> <argTreeModel idref="argTreeModel1"/> </argWideExchange>
<array> element
This element returns an array of the objects it contains.
The element has the following contents:
- Object elements (one or more)
- Objects to be put in an array
Example:
<array> <treeTraceAnalysis idref="treeTraceAnalysis8"/> <normalDistributionModel idref="normalDistributionModel6"/> <operators idref="operators4"/> </array>
<ascertainedPatterns> element
A weighted list of the unique site patterns (unique columns) in an alignment.
The element takes following attributes:
- Attribute (optional)
fromis Integer- The site position to start at, default is 1 (the first position)
- Attribute (optional)
tois Integer- The site position to finish at, must be greater than from, default is length of given alignment
- Attribute (optional)
everyis Integer- Determines how many sites are selected. A value of 3 will select every third site starting from from, default is 1 (every site)
The element has the following contents:
- Element named
<taxonList>containing:- TaxonList element (exactly one)
- TaxonList element (exactly one)
- Alignment element (exactly one)
- <includePatterns from="Z" to="X"/>*:<excludePatterns from="Z" to="X"/>
Example:
<ascertainedPatterns from="1" to="1" every="1"> <hypermutantAlignment idref="hypermutantAlignment8"/> </ascertainedPatterns>
<ASYMQUADModel> element
This element represents an instance of the stepwise mutation model of microsatellite evolution.
The element takes following attributes:
- Attribute (optional)
isSubmodelis Boolean
The element has the following contents:
- Microsatellite element (exactly one)
- FrequencyModel element (zero or one)
- Element named
<ExpansionConstant>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<ContractionConstant>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<ExpansionLinear>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<ContractionLinear>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<ExpansionQuad>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<ContractionQuad>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<ASYMQUADModel isSubmodel="true"> <microsatellite idref="microsatellite3"/> </ASYMQUADModel>
<attr> element
This element represents a name/value pair.
The element takes following attributes:
- Attribute
nameis String- The name to give to this attribute
The element has the following contents:
- Object element (exactly one)
Example:
<attr name="foo"> <hypermutantErrorModel idref="hypermutantErrorModel6"/> </attr>
<attributePatterns> element
A site pattern defined by an attribute in a set of taxa.
The element takes following attributes:
- Attribute
attributeis String
The element has the following contents:
- TaxonList element (exactly one)
- The taxon set
Example:
<attributePatterns attribute="foo"> <extendedDataType idref="extendedDataType10"/> <attributePatterns idref="attributePatterns1"/> </attributePatterns>
<attributes> element
This element represents an array of name/value pairs.
The element takes following attributes:
Example:
<attributes names="foo bar" values="foo bar"/>
<avgPosteriorIBDReporter> element
This element represents a reporter for average expected number of tips ibd conditional on observed patterns.
The element has the following contents:
- TreeModel element (exactly one)
- BranchRateModel element (zero or one)
- AbstractSubstitutionModel element (exactly one)
- Parameter element (exactly one)
- NodePosteriorTreeLikelihood element (exactly one)
Example:
<avgPosteriorIBDReporter> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/> <LINEARBIASModel idref="LINEARBIASModel8"/> <maskedParameter idref="maskedParameter6"/> ERROR! </avgPosteriorIBDReporter>
<ancestralTreeLikelihood> element
This element represents the likelihood of a patternlist on a tree given the site model.
The element takes following attributes:
- Attribute (optional)
useAmbiguitiesis Boolean - Attribute (optional)
storePartialsis Boolean - Attribute (optional)
tagNameis String - Attribute (optional)
forceRescalingis Boolean - Attribute (optional)
useMAPis Boolean - Attribute (optional)
useMarginalLikelihoodis Boolean
The element has the following contents:
- PatternList element (exactly one)
- TreeModel element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (zero or one)
- SubstitutionModel element (exactly one)
Example:
<ancestralTreeLikelihood useAmbiguities="true" storePartials="true" tagName="foo" forceRescaling="true" useMAP="true" useMarginalLikelihood="true"> <ascertainedPatterns idref="ascertainedPatterns8"/> <treeModel idref="treeModel6"/> <siteModel idref="siteModel7"/> <MutationDeathModel idref="MutationDeathModel8"/> </ancestralTreeLikelihood>
<complexSubstitutionModel> element
A general reversible model of sequence substitution for any data type with stochastic variable selection.
The element takes following attributes:
- Attribute (optional)
randomizeIndicatoris Boolean - Attribute (optional)
normalizeis Boolean - Attribute (optional)
maxConditionNumberis Double - Attribute (optional)
mustBeConnectedis Boolean - Attribute (optional)
maxIterationsis Integer - Attribute (optional)
checkConditioningis Boolean
The element has the following contents:
- Element named
<rootFrequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<rateIndicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<complexSubstitutionModel dataType="amino acid" randomizeIndicator="true" normalize="true" maxConditionNumber="1.0" mustBeConnected="true" maxIterations="1" checkConditioning="true"> <rootFrequencies> <frequencyModel idref="frequencyModel1"/> </rootFrequencies> <rates> <matrixParameter idref="matrixParameter9"/> </rates> </complexSubstitutionModel>
<DirichletSiteModel> element
A SiteModel that has Dirichlet distributed rates across sites
The element has the following contents:
- Element named
<substitutionModel>containing:- SubstitutionModel element (exactly one)
- SubstitutionModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<DirichletSiteModel> <substitutionModel> <mkSubstitutionModel idref="mkSubstitutionModel10"/> </substitutionModel> <rates> <duplicatedParameter idref="duplicatedParameter7"/> </rates> </DirichletSiteModel>
<frequencyModel> element
A model of equilibrium base frequencies.
The element takes following attributes:
- Attribute (optional)
normalizeis Boolean
The element has the following contents:
- PatternList element (zero or one)
- Initial value
- One of:
- Element named
<frequencies>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<frequencyModel normalize="true" dataType="codon-yeast"> <frequencies> <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/> </frequencies> </frequencyModel>
<siteModel> element
A SiteModel that has a gamma distributed rates across sites
The element has the following contents:
- Element named
<substitutionModel>containing:- SubstitutionModel element (exactly one)
- SubstitutionModel element (exactly one)
- One of:
- Element named
<gammaShape>containing: - Element named
<proportionInvariant>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<siteModel> <substitutionModel> <LINEARBIASModel idref="LINEARBIASModel6"/> </substitutionModel> <mutationRate> <parameter idref="parameter4"/> </mutationRate> </siteModel>
<benchmarker> element
This element runs a benchmark on a series of likelihood calculators.
The element takes following attributes:
- Attribute
iterationCountis Integer
The element has the following contents:
- Likelihood elements (one or more)
Example:
<benchmarker iterationCount="1"> <discretizedBranchRates idref="discretizedBranchRates9"/> </benchmarker>
<betaSplittingModel> element
The beta-splitting family of tree branching models (Aldous, 1996;2001).
The element has the following contents:
- Element named
<phi>containing:- Parameter element (exactly one)
- A parameter that ranges from -infinity (comb-tree) to +infinity (balanced tree)
- Parameter element (exactly one)
- Element named
<branchingTree>containing:- Tree element (exactly one)
- Tree element (exactly one)
Example:
<betaSplittingModel> <phi> <compoundSymmetricMatrix idref="compoundSymmetricMatrix4"/> </phi> <branchingTree> <speciesTree idref="speciesTree9"/> </branchingTree> </betaSplittingModel>
<binaryCovarionModel> element
A covarion substitution model on binary data and a hidden rate state with two rates.
The element has the following contents:
- Element named
<frequencies>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<hiddenFrequencies>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<alpha>containing:- Parameter element (zero or one)
- Parameter element (zero or one)
- Element named
<switchingRate>containing:- Parameter element (zero or one)
- Parameter element (zero or one)
Example:
<binaryCovarionModel> <frequencies> <maskedParameter idref="maskedParameter3"/> </frequencies> <hiddenFrequencies> <duplicatedParameter idref="duplicatedParameter5"/> </hiddenFrequencies> <alpha/> <switchingRate/> </binaryCovarionModel>
<binarySubstitutionModel> element
A general reversible model of sequence substitution for binary data type.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
Example:
<binarySubstitutionModel> <frequencies> <frequencyModel idref="frequencyModel9"/> </frequencies> </binarySubstitutionModel>
<binomialLikelihood> element
Calculates the likelihood of some data given some parametric or empirical distribution.
The element has the following contents:
- Element named
<trials>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<proportion>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<counts>containing:- Attribute
valuesis Integer;
- Attribute
Example:
<binomialLikelihood> <trials> <parameter idref="parameter3"/> </trials> <proportion> <maskedParameter idref="maskedParameter2"/> </proportion> <counts values="1 2 4 8"/> </binomialLikelihood>
<birthDeathModel> element
Gernhard (2008) model of speciation (equation at bottom of page 19 of draft).
The element takes following attributes:
- Attribute (optional)
typeis String - Attribute (optional)
conditionalOnRootis Boolean - Attribute
unitsis String- the units
The element has the following contents:
- Element named
<birthMinusDeathRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<relativeDeathRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<sampleRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<birthDeathModel type="foo" conditionalOnRoot="true" units="years"> <birthMinusDeathRate> <diagonalMatrix idref="diagonalMatrix5"/> </birthMinusDeathRate> <relativeDeathRate> <maskedParameter idref="maskedParameter4"/> </relativeDeathRate> </birthDeathModel>
<bitFlipInSubstitutionModelOperator> element
This element returns a bit-flip operator on a given indicatorParameter.
The element takes following attributes:
- Attribute
weightis Double - Attribute
scaleFactoris Double - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- Parameter element (zero or one)
- BayesianStochasticSearchVariableSelection element (exactly one)
Example:
<bitFlipInSubstitutionModelOperator weight="1.0" scaleFactor="1.0" autoOptimize="true"> ERROR! </bitFlipInSubstitutionModelOperator>
<bitFlipOperator> element
This element returns a bit-flip operator on a given parameter.
The element takes following attributes:
The element has the following contents:
- Parameter element (exactly one)
Example:
<bitFlipOperator weight="1.0" usesPriorOnSum="true"> <diagonalMatrix idref="diagonalMatrix4"/> </bitFlipOperator>
<bitMoveOperator> element
This element returns a bit-move operator on a given parameter.
The element takes following attributes:
The element has the following contents:
- Element named
<bits>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<values>containing:- Parameter element (exactly one)
- values parameter
- Parameter element (exactly one)
Example:
<bitMoveOperator weight="1.0" numBitsToMove="1"> <bits> <parameter idref="parameter1"/> </bits> </bitMoveOperator>
<bitSwapOperator> element
This element returns a bit-swap operator on a given parameter and data.
The element takes following attributes:
The element has the following contents:
- Element named
<data>containing:- Statistic element (exactly one)
- Statistic element (exactly one)
- Element named
<indicators>containing:- Statistic element (exactly one)
- Statistic element (exactly one)
Example:
<bitSwapOperator weight="1.0" radius="1.0"> <data> <partitionStatistic idref="partitionStatistic9"/> </data> <indicators> <treeLengthStatistic idref="treeLengthStatistic5"/> </indicators> </bitSwapOperator>
<booleanLikelihood> element
A function that log likelihood of a set of boolean statistics. If all the statistics are true then it returns 0.0 otherwise -infinity.
The element has the following contents:
- BooleanStatistic elements (one or more)
Example:
<booleanLikelihood> <compatibilityStatistic idref="compatibilityStatistic5"/> <compatibilityStatistic idref="compatibilityStatistic2"/> <monotonicStatistic idref="monotonicStatistic3"/> <compatibilityStatistic idref="compatibilityStatistic5"/> </booleanLikelihood>
<branchDirections> element
null
The element has the following contents:
- SampledMultivariateTraitLikelihood element (exactly one)
Example:
<branchDirections> ERROR! </branchDirections>
<branchingLikelihood> element
This element represents the likelihood of the tree given the demographic function.
The element has the following contents:
- Element named
<model>containing:- BranchingModel element (exactly one)
- BranchingModel element (exactly one)
- Element named
<branchingTree>containing:- TreeModel element (exactly one)
- TreeModel element (exactly one)
Example:
<branchingLikelihood> <model> <betaSplittingModel idref="betaSplittingModel3"/> </model> <branchingTree> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/> </branchingTree> </branchingLikelihood>
<branchMagnitudes> element
null
The element takes following attributes:
- Attribute (optional)
scaleByLengthis Boolean
The element has the following contents:
- AbstractMultivariateTraitLikelihood element (exactly one)
Example:
<branchMagnitudes scaleByLength="true"> <inhibitionLikelihood idref="inhibitionLikelihood3"/> </branchMagnitudes>
<BrownianMotion> element
The element takes following attributes:
- Attribute (optional)
logUnitsis Boolean
The element has the following contents:
- One of:
- VariableDemographicModel element (exactly one)
Example:
<BrownianMotion logUnits="true"> <sigma> 1.0 </sigma> <variableDemographic idref="variableDemographic7"/> </BrownianMotion>
<cachedPrior> element
Calculates a cached likelihood of some data given some parametric or empirical distribution.
The element has the following contents:
- AbstractDistributionLikelihood element (exactly one)
- Variable element (exactly one)
Example:
<cachedPrior> <cachedPrior idref="cachedPrior6"/> <diagonalMatrix idref="diagonalMatrix1"/> </cachedPrior>
<cartogramDiffusionModel> element
Describes a bivariate diffusion process using cartogram distances.
The element takes following attributes:
- Attribute (optional)
cartogramFileNameis String - Attribute
xGridSizeis Integer - Attribute
yGridSizeis Integer
The element has the following contents:
- Parameter element (exactly one)
- Element named
<boundingBox>containing:
Example:
<cartogramDiffusionModel cartogramFileName="foo" xGridSize="1" yGridSize="1"> <designMatrix idref="designMatrix10"/> <boundingBox minX="1.0" maxX="1.0" minY="1.0" maxY="1.0"/> </cartogramDiffusionModel>
<cataclysm> element
A demographic model of exponential growth.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<growthRate>containing:- Parameter element (exactly one)
- The rate of exponential growth before the cataclysmic event.
- Parameter element (exactly one)
- Element named
<spikeFactor>containing:- Parameter element (exactly one)
- The factor larger the population size was at its height.
- Parameter element (exactly one)
- Element named
<timeOfCataclysm>containing:- Parameter element (exactly one)
- The time of the cataclysmic event that lead to exponential decline.
- Parameter element (exactly one)
Example:
<cataclysm units="years"> <populationSize> <maskedParameter idref="maskedParameter2"/> </populationSize> <growthRate> <compoundParameter idref="compoundParameter6"/> </growthRate> <spikeFactor> <diagonalMatrix idref="diagonalMatrix2"/> </spikeFactor> <timeOfCataclysm> <duplicatedParameter idref="duplicatedParameter4"/> </timeOfCataclysm> </cataclysm>
<categorySiteModel> element
A SiteModel that has a gamma distributed rates across sites
The element has the following contents:
- Element named
<substitutionModel>containing:- SubstitutionModel element (exactly one)
- SubstitutionModel element (exactly one)
- Element named
<mutationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<rates>containing: - Element named
<categories>containing:
Example:
<categorySiteModel> <substitutionModel> <positiveDefiniteSubstitutionModel idref="positiveDefiniteSubstitutionModel4"/> </substitutionModel> <mutationRate> <compoundParameter idref="compoundParameter8"/> </mutationRate> </categorySiteModel>
<centeredScale> element
A centered-scale operator. This operator scales the the values of a multi-dimensional parameter so as to perserve the mean. It does this by expanding or conrtacting the parameter values around the mean.
The element takes following attributes:
- Attribute
weightis Double - Attribute
scaleFactoris Double - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- Parameter element (exactly one)
Example:
<centeredScale weight="1.0" scaleFactor="1.0" autoOptimize="true"> <duplicatedParameter idref="duplicatedParameter8"/> </centeredScale>
<circle> element
This element represents a regular circle polygon.
The element takes following attributes:
- Attribute
latitudeis Double - Attribute
longitudeis Double - Attribute
radiusis Double - Attribute (optional)
numberOfPointsis Integer
Example:
<circle latitude="1.0" longitude="1.0" radius="1.0" numberOfPoints="1"/>
<coalescentIntervalStatistic> element
The element has the following contents:
- GMRFSkyrideLikelihood element (exactly one)
Example:
<coalescentIntervalStatistic> <gmrfTestLikelihood idref="gmrfTestLikelihood4"/> </coalescentIntervalStatistic>
<coalescentLikelihood> element
This element represents the likelihood of the tree given the demographic function.
The element has the following contents:
- Element named
<model>containing:- DemographicModel element (exactly one)
- The demographic model which describes the effective population size over time
- DemographicModel element (exactly one)
- Element named
<populationTree>containing: - Element named
<include>containing:- Taxa element (exactly one)
- An optional subset of taxa on which to calculate the likelihood (should be monophyletic)
- Taxa element (exactly one)
- Element named
<exclude>containing:- Taxa elements (one or more)
- One or more subsets of taxa which should be excluded from calculate the likelihood (should be monophyletic)
- Taxa elements (one or more)
Example:
<coalescentLikelihood> <model> <scaledPiecewisePopulation idref="scaledPiecewisePopulation9"/> </model> <populationTree factor="1.0"> <treeModel idref="treeModel9"/> </populationTree> <populationTree factor="1.0"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2"/> </populationTree> </coalescentLikelihood>
<coalescentTree> element
This element returns a simulated tree under the given demographic model.
The element takes following attributes:
- Attribute (optional)
rescaleHeightis Double- Attempt to rescale the tree to the given root height
- Attribute (optional)
rootHeightis Double- '
The element has the following contents:
- Tree elements (zero or more)
- TaxonList elements (zero or more)
- Element named
<constrainedTaxa>containing:- TaxonList elements (zero or more)
- TaxonList elements (zero or more)
- DemographicModel element (exactly one)
Example:
<coalescentTree rescaleHeight="1.0" rootHeight="1.0"> <argTreeModel idref="argTreeModel5"/> <speciesTree idref="speciesTree7"/> <upgmaTree idref="upgmaTree8"/> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1"/> <patterns idref="patterns2"/> <alignment idref="alignment8"/> <newick idref="newick5"/> <constantExponential idref="constantExponential7"/> </coalescentTree>
<column> element
Specifies formating options for one or more columns in a log file.
The element takes following attributes:
- Attribute (optional)
labelis String- The label of the column. If this is specified and more than one statistic is in this column, then the label will be appended by the index of the statistic to create individual column names
- Attribute (optional)
sfis Integer - Attribute (optional)
dpis Integer - Attribute (optional)
widthis Integer - Attribute (optional)
formatis String
The element has the following contents:
- Object elements (one or more)
Example:
<column label="foo" sf="1" dp="1" width="1" format="foo"> <continuousTraitRateModel idref="continuousTraitRateModel3"/> <logML idref="logML10"/> <designMatrix idref="designMatrix10"/> </column>
<compatibilityStatistic> element
A statistic that returns true if a pair of trees are compatible
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic for the purpose of logging
The element has the following contents:
- Tree element (exactly one)
- Element named
<compatibleWith>containing:- Tree element (exactly one)
- Tree element (exactly one)
- Tree element (exactly one)
Example:
<compatibilityStatistic name="foo"> <treeModel idref="treeModel8"/> <compatibleWith> <argTreeModel idref="argTreeModel4"/> </compatibleWith> <argTreeModel idref="argTreeModel7"/> </compatibilityStatistic>
<complexSubstitutionModel> element
A general reversible model of sequence substitution for any data type with stochastic variable selection.
The element takes following attributes:
- Attribute (optional)
randomizeIndicatoris Boolean - Attribute (optional)
normalizeis Boolean - Attribute (optional)
maxConditionNumberis Double - Attribute (optional)
mustBeConnectedis Boolean - Attribute (optional)
maxIterationsis Integer - Attribute (optional)
checkConditioningis Boolean
The element has the following contents:
- Element named
<rootFrequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<rateIndicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<complexSubstitutionModel randomizeIndicator="true" normalize="true" maxConditionNumber="1.0" mustBeConnected="true" maxIterations="1" checkConditioning="true"> <hiddenNucleotides idref="hiddenNucleotides2"/> <rootFrequencies> <frequencyModel idref="frequencyModel2"/> </rootFrequencies> <rates> <maskedParameter idref="maskedParameter10"/> </rates> </complexSubstitutionModel>
<compoundBranchRateModel> element
This element provides a strict clock model. All branches have the same rate of molecular evolution.
The element has the following contents:
- BranchRateModel elements (one or more)
- The component branch rate models
Example:
<compoundBranchRateModel> <localClockModel idref="localClockModel6"/> <arbitraryBranchRates idref="arbitraryBranchRates9"/> <argDiscretizedBranchRates idref="argDiscretizedBranchRates9"/> </compoundBranchRateModel>
<compoundLikelihood> element
A likelihood function which is simply the product of its component likelihood functions.
The element takes following attributes:
- Attribute (optional)
threadsis Integer
The element has the following contents:
- Likelihood elements (one or more)
Example:
<compoundLikelihood threads="1"> <coalescentLikelihood idref="coalescentLikelihood8"/> <speciesTreePopulationPrior idref="speciesTreePopulationPrior3"/> </compoundLikelihood>
<compoundParameter> element
A multidimensional parameter constructed from its component parameters.
The element has the following contents:
- Parameter elements (one or more)
Example:
<compoundParameter> <designMatrix idref="designMatrix4"/> </compoundParameter>
<compoundSymmetricMatrix> element
A diagonal matrix parameter constructed from its diagonals.
The element takes following attributes:
- Attribute (optional)
asCorrelationis Boolean
The element has the following contents:
- Element named
<diagonal>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<offDiagonal>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<compoundSymmetricMatrix asCorrelation="true"> <diagonal> <designMatrix idref="designMatrix9"/> </diagonal> <offDiagonal> <compoundParameter idref="compoundParameter8"/> </offDiagonal> </compoundSymmetricMatrix>
<constantExponential> element
A demographic model of constant population size followed by exponential growth.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<growthPhaseStartTime>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- One of:
- Element named
<growthRate>containing:- Parameter element (exactly one)
- A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
- Parameter element (exactly one)
- Element named
<doublingTime>containing:- Parameter element (exactly one)
- This parameter determines the doubling time.
- Parameter element (exactly one)
- Element named
Example:
<constantExponential units="generations"> <populationSize> <matrixParameter idref="matrixParameter1"/> </populationSize> <growthPhaseStartTime> <matrixParameter idref="matrixParameter7"/> </growthPhaseStartTime> <doublingTime> <compoundSymmetricMatrix idref="compoundSymmetricMatrix3"/> </doublingTime> </constantExponential>
<constantLogistic> element
A demographic model of constant population size followed by logistic growth.
The element takes following attributes:
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<ancestralPopulationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<growthRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<shape>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<constantLogistic units="substitutions" alpha="1.0"> <populationSize> <diagonalMatrix idref="diagonalMatrix10"/> </populationSize> <ancestralPopulationSize> <maskedParameter idref="maskedParameter4"/> </ancestralPopulationSize> <growthRate> <designMatrix idref="designMatrix6"/> </growthRate> <shape> <designMatrix idref="designMatrix6"/> </shape> </constantLogistic>
<constantSize> element
A demographic model representing a constant population size through time.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<constantSize units="years"> <populationSize> <diagonalMatrix idref="diagonalMatrix1"/> </populationSize> </constantSize>
<constExpConst> element
A demographic model of constant population size followed by exponential growth.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<ancestralPopulationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<finalPhaseStartTime>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- One of:
- Element named
<growthRate>containing:- Parameter element (exactly one)
- A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
- Parameter element (exactly one)
- Element named
<doublingTime>containing:- Parameter element (exactly one)
- This parameter determines the doubling time.
- Parameter element (exactly one)
- Element named
Example:
<constExpConst units="days"> <populationSize> <compoundSymmetricMatrix idref="compoundSymmetricMatrix4"/> </populationSize> <ancestralPopulationSize> <parameter idref="parameter10"/> </ancestralPopulationSize> <finalPhaseStartTime> <compoundParameter idref="compoundParameter3"/> </finalPhaseStartTime> <doublingTime> <maskedParameter idref="maskedParameter9"/> </doublingTime> </constExpConst>
<continuousTraitRateModel> element
This element returns an trait rate model.The branch rates are an average of the rates provided by a node trait.
The element takes following attributes:
- Attribute (optional)
dimensionis Integer- The dimension that supplies the rate
The element has the following contents:
- Element named
<rate>containing:- Parameter element (exactly one)
- The rate parameter
- Parameter element (exactly one)
- Element named
<ratio>containing:- Parameter element (exactly one)
- The ratio parameter
- Parameter element (exactly one)
- SampledMultivariateTraitLikelihood element (zero or one)
Example:
<continuousTraitRateModel dimension="1"/>
<convert> element
Converts an alignment to the given data type.
The element takes following attributes:
- Attribute
dataTypeis String- The type of sequence data
The element has the following contents:
- Alignment element (exactly one)
Example:
<convert dataType="codon"> <alignment idref="alignment5"/> </convert>
<coordinates> element
This element represents a set of (X,Y,Z) coordinates in KML format
The element has the following contents:
- String element (exactly one)
Example:
<coordinates> foo </coordinates>
<correlation> element
This element returns a precision that is the element-wise reciprocal of the child precision.
The element takes following attributes:
The element has the following contents:
- MatrixParameter element (exactly one)
Example:
<correlation dimension1="1" dimension2="1"> <matrixParameter idref="matrixParameter1"/> </correlation>
<CovarionHKYModel> element
A covarion HKY model.
The element has the following contents:
- Element named
<kappa>containing:- Parameter element (exactly one)
- A parameter representing the transition transversion bias
- Parameter element (exactly one)
- Element named
<switchingRates>containing:- Parameter element (exactly one)
- A parameter representing the rate of change between the different classes
- Parameter element (exactly one)
- Element named
<hiddenClassRates>containing:- Parameter element (exactly one)
- A parameter representing the rates of the hidden classes relative to the first hidden class.
- Parameter element (exactly one)
Example:
<CovarionHKYModel> <kappa> <compoundParameter idref="compoundParameter4"/> </kappa> <switchingRates> <duplicatedParameter idref="duplicatedParameter10"/> </switchingRates> <hiddenClassRates> <matrixParameter idref="matrixParameter6"/> </hiddenClassRates> </CovarionHKYModel>
<covarionModel> element
A covarion substitution model on binary data and a hidden rate state with two rates.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<alpha>containing:- Parameter element (zero or one)
- Parameter element (zero or one)
- Element named
<switchingRate>containing:- Parameter element (zero or one)
- Parameter element (zero or one)
Example:
<covarionModel> <frequencies> <frequencyModel idref="frequencyModel8"/> </frequencies> <alpha/> <switchingRate/> </covarionModel>
<CSVexport> element
Write tabular data as an CSV file.
The element takes following attributes:
- Attribute
fileNameis String- The name of a BEAST log file (can not include trees, which should be logged separately
- Attribute (optional)
separatoris String- Values separator (default is tab)
The element has the following contents:
- Element named
<columns>containing:- Attribute (optional)
allis Boolean- Dump all columns. default is TRUE when no columns are specified, FALSE otherwise
- Attribute (optional)
rowsis Boolean- Write data in rows (default is columns)
- TabularData element (exactly one)
- Element named
<CSVcolumn>containing:- A subset of columns from one source
- Attribute (optional)
Example:
<CSVexport fileName="foo" separator="foo">
<columns all="true" rows="true">
<logFileTrace idref="logFileTrace5"/>
<CSVcolumn name="foo bar">
<compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/>
</CSVcolumn>
<CSVcolumn name="foo bar">
<diagonalMatrix idref="diagonalMatrix4"/>
</CSVcolumn>
<CSVcolumn name="foo bar">
<compoundParameter idref="compoundParameter6"/>
</CSVcolumn>
</columns>
<columns all="true" rows="true">
<VDAnalysis idref="VDAnalysis10"/>
<CSVcolumn name="foo bar">
<matrixParameter idref="matrixParameter7"/>
</CSVcolumn>
</columns>
<columns all="true" rows="true">
<logFileTrace idref="logFileTrace1"/>
<CSVcolumn name="foo bar">
<compoundParameter idref="compoundParameter8"/>
</CSVcolumn>
<CSVcolumn name="foo bar">
<maskedParameter idref="maskedParameter5"/>
</CSVcolumn>
</columns>
<columns all="true" rows="true">
<VDAnalysis idref="VDAnalysis1"/>
<CSVcolumn name="foo bar">
<maskedParameter idref="maskedParameter10"/>
</CSVcolumn>
<CSVcolumn name="foo bar">
<maskedParameter idref="maskedParameter10"/>
</CSVcolumn>
<CSVcolumn name="foo bar">
<parameter idref="parameter10"/>
</CSVcolumn>
</columns>
</CSVexport>
<ctmcScalePrior> element
This element represents the prior for CTMC scale parameter.
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<ctmcScale>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<ctmcScalePrior> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel10"/> <ctmcScale> <duplicatedParameter idref="duplicatedParameter7"/> </ctmcScale> </ctmcScalePrior>
<date> element
Specifies a date on a given timescale
The element takes following attributes:
- Attribute
valueis String- The value of this date
- Attribute (optional)
originis String- The origin of this time scale, which must be a valid calendar date
- Attribute (optional)
unitsis String- The units of the timescale
- Attribute (optional)
directionis String- The direction of the timescale
Example:
<!-- a date representing 10 years in the past --> <date value="10.0" units="years" direction="backwards"/> <!-- a date representing 300 days after Jan 1st 1989 --> <date value="300.0" origin="01/01/89" units="days" direction="forwards"/>
<deltaExchange> element
This element returns a scale operator on a given parameter.
The element takes following attributes:
- Attribute
deltais Double - Attribute (optional)
parameterWeightsis Integer; - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean - Attribute (optional)
integeris Boolean
The element has the following contents:
- Parameter element (exactly one)
Example:
<deltaExchange delta="1.0" parameterWeights="1 2 4 8" weight="1.0" autoOptimize="true" integer="true"> <diagonalMatrix idref="diagonalMatrix6"/> </deltaExchange>
<designMatrix> element
A matrix parameter constructed from its component parameters.
The element takes following attributes:
- Attribute (optional)
addInterceptis Boolean - Attribute (optional)
formis String - Attribute (optional)
colDimensionis Integer - Attribute (optional)
rowDimensionis Integer
The element has the following contents:
- Parameter elements (zero or more)
Example:
<designMatrix addIntercept="true" form="foo" colDimension="1" rowDimension="1"> <parameter idref="parameter8"/> <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/> <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/> </designMatrix>
<diagonalMatrix> element
A diagonal matrix parameter constructed from its diagonals.
The element has the following contents:
- Parameter element (exactly one)
Example:
<diagonalMatrix> <designMatrix idref="designMatrix10"/> </diagonalMatrix>
<differenceStatistic> element
This element returns a statistic that is the difference of the 2 child statistics.
The element takes following attributes:
- Attribute (optional)
absoluteis Boolean
The element has the following contents:
- Statistic elements (exactly 2)
- The two operand statistics
Example:
<differenceStatistic absolute="true"> <duplicatedParameter idref="duplicatedParameter5"/> <matrixParameter idref="matrixParameter2"/> </differenceStatistic>
<differenceStatistic> element
This element returns a statistic that is the difference of the 2 child statistics.
The element takes following attributes:
- Attribute (optional)
absoluteis Boolean
The element has the following contents:
- Statistic elements (exactly 2)
- The two operand statistics
Example:
<differenceStatistic absolute="true"> <RPNcalculator idref="RPNcalculator8"/> <negativeStatistic idref="negativeStatistic10"/> </differenceStatistic>
<diffusionRateStatistic> element
A statistic that returns the average of the branch rates
The element takes following attributes:
The element has the following contents:
- AbstractMultivariateTraitLikelihood elements (one or more)
Example:
<diffusionRateStatistic name="foo" greatCircleDistance="true"> <multivariateTraitLikelihood idref="multivariateTraitLikelihood2"/> <inhibitionLikelihood idref="inhibitionLikelihood9"/> </diffusionRateStatistic>
<dirichletPrior> element
Calculates the likelihood of some data under an Inverse-Wishart distribution.
The element has the following contents:
- Element named
<countsParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<dirichletPrior> <countsParameter> <maskedParameter idref="maskedParameter10"/> </countsParameter> </dirichletPrior>
<DirichletSiteModel> element
A SiteModel that has Dirichlet distributed rates across sites
The element has the following contents:
- Element named
<substitutionModel>containing:- SubstitutionModel element (exactly one)
- SubstitutionModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<DirichletSiteModel> <substitutionModel> <yangCodonModel idref="yangCodonModel8"/> </substitutionModel> <rates> <maskedParameter idref="maskedParameter7"/> </rates> </DirichletSiteModel>
<dirtyLikelihood> element
This element returns a operator that forces the entire model likelihood recomputation
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Likelihood element (exactly one)
Example:
<dirtyLikelihood weight="1.0"> <discreteTraitRateModel idref="discreteTraitRateModel7"/> </dirtyLikelihood>
<discreteTraitRateModel> element
This Branch Rate Model takes a discrete trait reconstruction (provided by a TreeTraitProvider) and gives the rate for each branch of the tree based on the child trait of that branch. The rates for each trait value are specified in a multidimensional parameter.
The element takes following attributes:
The element has the following contents:
- TreeModel element (exactly one)
- The tree model
- One of:
- All of:***TreeTraitProvider element (exactly one)
- PatternList element (exactly one)
- PatternList element (exactly one)
- Element named
<rate>containing:- Parameter element (exactly one)
- The absolute rate of state 0
- Parameter element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- The relative rates of state > 0
- Parameter element (exactly one)
- Element named
<indicators>containing:- Parameter element (exactly one)
- An index that links the state with a rate
- Parameter element (exactly one)
Example:
<discreteTraitRateModel traitIndex="1" traitName="foo"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel4"/> <rate> <compoundSymmetricMatrix idref="compoundSymmetricMatrix1"/> </rate> </discreteTraitRateModel>
<discretizedBranchRates> element
This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.
The element takes following attributes:
- Attribute (optional)
singleRootRateis Boolean- Whether only a single rate should be used for the two children branches of the root
- Attribute (optional)
overSamplingis Integer- The integer factor for oversampling the distribution model (1 means no oversampling)
- Attribute (optional)
normalizeis Boolean- Whether the mean rate has to be normalized to a particular value
- Attribute (optional)
normalizeBranchRateTois Double- The mean rate to normalize to, if normalizing
- Attribute (optional)
overSamplingis Integer- The integer factor for oversampling the distribution model (1 means no oversampling)
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<distribution>containing:- ParametricDistributionModel element (exactly one)
- The distribution model for rates among branches
- ParametricDistributionModel element (exactly one)
- Element named
<rateCategories>containing:- Parameter element (exactly one)
- The rate categories parameter
- Parameter element (exactly one)
Example:
<discretizedBranchRates singleRootRate="true" overSampling="1" normalize="true" normalizeBranchRateTo="1.0" overSampling="1"> <treeModel idref="treeModel1"/> <distribution> <exponentialDistributionModel idref="exponentialDistributionModel4"/> </distribution> <rateCategories> <parameter idref="parameter7"/> </rateCategories> </discretizedBranchRates>
<discretizedLocationOperator> element
This element returns a multivariate Gibbs operator on traits for possible all nodes.
The element takes following attributes:
- Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean - Attribute (optional)
onlyInternalNodesis Boolean - Attribute (optional)
neighborhoodSizeis Integer - Attribute (optional)
randomizeis Boolean
The element has the following contents:
- AbstractMultivariateTraitLikelihood element (exactly one)
Example:
<discretizedLocationOperator weight="1.0" autoOptimize="true" onlyInternalNodes="true" neighborhoodSize="1" randomize="true"> <multivariateTraitLikelihood idref="multivariateTraitLikelihood8"/> </discretizedLocationOperator>
<distanceMatrix> element
Constructs a distance matrix from a pattern list or alignment
The element takes following attributes:
- Attribute
correctionis String- The type of distance correction used
The element has the following contents:
- PatternList element (exactly one)
Example:
<distanceMatrix correction="F84"> <sequenceSimulator idref="sequenceSimulator4"/> </distanceMatrix>
<distributionLikelihood> element
Calculates the likelihood of some data given some parametric or empirical distribution.
The element has the following contents:
- Element named
<distribution>containing:- ParametricDistributionModel element (exactly one)
- ParametricDistributionModel element (exactly one)
- Element named
<data>containing:
Example:
<distributionLikelihood> <distribution> <inverseGaussianDistributionModel idref="inverseGaussianDistributionModel9"/> </distribution> <data from="1" to="1"> <treeMetricStatistic idref="treeMetricStatistic1"/> <sumStatistic idref="sumStatistic10"/> <speciesTreeStatistic idref="speciesTreeStatistic9"/> <notStatistic idref="notStatistic4"/> </data> </distributionLikelihood>
<double> element
returns a Double. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as a Double.
The element has the following contents:
- One of:
Example:
<double> 1.0 </double>
<dummyLikelihood> element
A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.
The element has the following contents:
- Model element (exactly one)
- A model element
Example:
<dummyLikelihood> <TN93Model idref="TN93Model8"/> </dummyLikelihood>
<dummyModel> element
A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.
The element has the following contents:
- Parameter elements (one or more)
Example:
<dummyModel> <maskedParameter idref="maskedParameter4"/> <diagonalMatrix idref="diagonalMatrix7"/> <compoundSymmetricMatrix idref="compoundSymmetricMatrix2"/> </dummyModel>
<duplicatedParameter> element
A duplicated parameter.
The element has the following contents:
Example:
<duplicatedParameter> <designMatrix idref="designMatrix9"/> <copies> <designMatrix idref="designMatrix7"/> </copies> </duplicatedParameter>
<empiricalDistributionLikelihood> element
Calculates the likelihood of some data given some empirically-generated distribution.
The element takes following attributes:
- Attribute
fileNameis String - Attribute (optional)
splineInterpolationis Boolean - Attribute (optional)
degreeis Integer - Attribute (optional)
inverseis Boolean - Attribute (optional)
readByColumnis Boolean
The element has the following contents:
- Element named
<data>containing:
Example:
<empiricalDistributionLikelihood fileName="foo" splineInterpolation="true" degree="1" inverse="true" readByColumn="true"> <data from="1" to="1" offset="1.0"> <reciprocalStatistic idref="reciprocalStatistic5"/> </data> </empiricalDistributionLikelihood>
<empiricalPiecewise> element
This element represents a piecewise population model
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<intervalWidths>containing:- Attribute
valuesis Double;
- Attribute
- Element named
<populationSizes>containing:- Parameter element (exactly one)
- The effective population sizes of each interval.
- Parameter element (exactly one)
- Element named
<generationLength>containing:- Parameter element (exactly one)
- The scale factor.
- Parameter element (exactly one)
- Element named
<threshold>containing:- Parameter element (exactly one)
- The threshold before counts occur.
- Parameter element (exactly one)
- Element named
<lag>containing:- Parameter element (exactly one)
- The lag between actual population sizes and genetic diversity.
- Parameter element (exactly one)
Example:
<empiricalPiecewise units="days"> <intervalWidths values="0.5 1.0"/> <populationSizes> <compoundParameter idref="compoundParameter3"/> </populationSizes> <generationLength> <compoundParameter idref="compoundParameter5"/> </generationLength> <threshold> <maskedParameter idref="maskedParameter7"/> </threshold> <lag> <compoundParameter idref="compoundParameter8"/> </lag> </empiricalPiecewise>
<empiricalTreeDistributionModel> element
Read a list of trees from a NEXUS file.
The element takes following attributes:
- Attribute
fileNameis String- The name of a NEXUS tree file
The element has the following contents:
- TaxonList element (exactly one)
Example:
<empiricalTreeDistributionModel fileName="foo"> <attributePatterns idref="attributePatterns2"/> </empiricalTreeDistributionModel>
<empiricalTreeDistributionOperator> element
Operator which switches between trees in an empirical distribution.
The element takes following attributes:
The element has the following contents:
- EmpiricalTreeDistributionModel element (exactly one)
Example:
<empiricalTreeDistributionOperator weight="1.0" metropolisHastings="true"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/> </empiricalTreeDistributionOperator>
<exponentialStatistic> element
This element returns a statistic that is the element-wise exponentiation of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<exponentialStatistic> <parsimonyStateStatistic idref="parsimonyStateStatistic8"/> </exponentialStatistic>
<expansion> element
A demographic model of constant population size followed by exponential growth.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<ancestralPopulationProportion>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- One of:
- Element named
<growthRate>containing:- Parameter element (exactly one)
- A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
- Parameter element (exactly one)
- Element named
<doublingTime>containing:- Parameter element (exactly one)
- This parameter determines the doubling time.
- Parameter element (exactly one)
- Element named
Example:
<expansion units="mutations"> <populationSize> <duplicatedParameter idref="duplicatedParameter4"/> </populationSize> <ancestralPopulationProportion> <duplicatedParameter idref="duplicatedParameter2"/> </ancestralPopulationProportion> <growthRate> <matrixParameter idref="matrixParameter1"/> </growthRate> </expansion>
<expConstExp> element
A demographic model of exponential growth.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<relativePlateauSize>containing:- Parameter element (exactly one)
- The size of plateau relative to modern population size.
- Parameter element (exactly one)
- Element named
<relTimeModGrowth>containing:- Parameter element (exactly one)
- The time spanned by modern growth phase relative to time back to start of plateau phase.
- Parameter element (exactly one)
- Element named
<plateauStartTime>containing:- Parameter element (exactly one)
- The time of the start of plateauPhase.
- Parameter element (exactly one)
- Element named
<ancientGrowthRate>containing:- Parameter element (exactly one)
- The growth rate of early growth phase
- Parameter element (exactly one)
Example:
<expConstExp units="generations"> <populationSize> <duplicatedParameter idref="duplicatedParameter10"/> </populationSize> <relativePlateauSize> <diagonalMatrix idref="diagonalMatrix3"/> </relativePlateauSize> <relTimeModGrowth> <designMatrix idref="designMatrix9"/> </relTimeModGrowth> <plateauStartTime> <matrixParameter idref="matrixParameter5"/> </plateauStartTime> <ancientGrowthRate> <parameter idref="parameter6"/> </ancientGrowthRate> </expConstExp>
<exponentialBranchLengthsPrior> element
This element represents a tree prior assuming exponentially distributed branch lengths.
The element has the following contents:
- TreeModel element (exactly one)
Example:
<exponentialBranchLengthsPrior> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8"/> </exponentialBranchLengthsPrior>
<exponentialDistributionModel> element
A model of an exponential distribution.
The element takes following attributes:
- Attribute (optional)
offsetis Double
The element has the following contents:
- One of:
Example:
<exponentialDistributionModel offset="1.0"> <mean> 1.0 </mean> </exponentialDistributionModel>
<exponentialGrowth> element
A demographic model of exponential growth.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- One of:
- Element named
<growthRate>containing:- Parameter element (exactly one)
- A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
- Parameter element (exactly one)
- Element named
<doublingTime>containing:- Parameter element (exactly one)
- This parameter determines the doubling time.
- Parameter element (exactly one)
- Element named
Example:
<exponentialGrowth units="mutations"> <populationSize> <compoundParameter idref="compoundParameter3"/> </populationSize> <doublingTime> <compoundSymmetricMatrix idref="compoundSymmetricMatrix8"/> </doublingTime> </exponentialGrowth>
<exponentialLogistic> element
A demographic model of constant population size followed by logistic growth.
The element takes following attributes:
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<logisticGrowthRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<logisticShape>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<exponentialGrowthRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<transitionTime>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<exponentialLogistic units="days" alpha="1.0"> <populationSize> <maskedParameter idref="maskedParameter5"/> </populationSize> <logisticGrowthRate> <parameter idref="parameter4"/> </logisticGrowthRate> <logisticShape> <duplicatedParameter idref="duplicatedParameter2"/> </logisticShape> <exponentialGrowthRate> <matrixParameter idref="matrixParameter7"/> </exponentialGrowthRate> <transitionTime> <designMatrix idref="designMatrix5"/> </transitionTime> </exponentialLogistic>
<exponentialMarkovLikelihood> element
A continuous state, discrete time markov chain in which each new state is an exponentially distributed variable with a mean of the previous state.
The element takes following attributes:
The element has the following contents:
- Element named
<chainParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<exponentialMarkovLikelihood jeffreys="true" reverse="true"> <chainParameter> <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/> </chainParameter> </exponentialMarkovLikelihood>
<exponentialPrior> element
Calculates the prior probability of some data under a given exponential distribution.
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<exponentialPrior mean="1.0" offset="1.0"> <speciesTreeStatistic idref="speciesTreeStatistic3"/> <treeLengthStatistic idref="treeLengthStatistic1"/> <negativeStatistic idref="negativeStatistic4"/> <argTimingStatistic idref="argTimingStatistic4"/> </exponentialPrior>
<exponentialSawtooth> element
A demographic model of succesive exponential growth and periodic population crashes.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<growthRate>containing:- Parameter element (exactly one)
- The rate of exponential growth during the growth phase.
- Parameter element (exactly one)
- Element named
<wavelength>containing:- Parameter element (exactly one)
- The wavelength between successive population crashes.
- Parameter element (exactly one)
- Element named
<offset>containing:- Parameter element (exactly one)
- The proportion of the last growth phase that is not achieved at the final sample time.
- Parameter element (exactly one)
Example:
<exponentialSawtooth units="generations"> <populationSize> <parameter idref="parameter5"/> </populationSize> <growthRate> <matrixParameter idref="matrixParameter6"/> </growthRate> <wavelength> <maskedParameter idref="maskedParameter7"/> </wavelength> <offset> <designMatrix idref="designMatrix5"/> </offset> </exponentialSawtooth>
<exponentialStatistic> element
This element returns a statistic that is the element-wise exponentiation of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<exponentialStatistic> <varianceStatistic idref="varianceStatistic8"/> </exponentialStatistic>
<expressionStatistic> element
This element returns a statistic that is the mean of the child statistics.
The element has the following contents:
- Element named
<expression>containing:- String element (exactly one)
- String element (exactly one)
- Element named
<variables>containing:- Statistic elements (one or more)
- Statistic elements (one or more)
Example:
<expressionStatistic> <expression> foo </expression> <variables> <differenceStatistic idref="differenceStatistic5"/> <popGraph idref="popGraph9"/> <exponentialStatistic idref="exponentialStatistic10"/> <argTreeCount idref="argTreeCount1"/> </variables> </expressionStatistic>
<extendedDataType> element
This element represents an instance of the MutationDeathType which extends a base datatype with an additional "death" state.
The element takes following attributes:
- Attribute (optional)
dataTypeis String- Base datatype name
The element has the following contents:
- DataType element (zero or one)
- Element named
<deathState>containing:- Attribute
codeis String
- Attribute
- Element named
<extantState>containing:- Attribute
codeis String
- <ambiguity code="Z" states="XY"/>
- Attribute
Example:
<extendedDataType dataType="codon-ascidianMitochondrial"/>
<externalLengthStatistic> element
A statistic that has as its value(s) the length of the external branch length(s) of a set of one or more taxa in a given tree
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
The element has the following contents:
Example:
<externalLengthStatistic name="foo"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel7"/> <taxa idref="taxa9"/> </externalLengthStatistic>
<FixedNodeheightSubtreePruneRegraft> element
This element represents a FNPR operator. This operator swaps a random subtree with its uncle.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- TreeModel element (exactly one)
Example:
<FixedNodeheightSubtreePruneRegraft weight="1.0"> <treeModel idref="treeModel1"/> </FixedNodeheightSubtreePruneRegraft>
<flatGeoSpatialPrior> element
Calculates the likelihood of some data under a 2D geospatial distribution.
The element takes following attributes:
- Attribute (optional)
taxonis String - Attribute (optional)
insideis Boolean - Attribute (optional)
unionis Boolean
The element has the following contents:
- Element named
<data>containing:- Parameter elements (one or more)
- Parameter elements (one or more)
Example:
<flatGeoSpatialPrior taxon="foo" inside="true" union="true" kmlFileName="foo"> <data> <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/> </data> </flatGeoSpatialPrior>
<frequencyModel> element
A model of equilibrium base frequencies.
The element takes following attributes:
- Attribute (optional)
normalizeis Boolean
The element has the following contents:
- PatternList element (zero or one)
- Initial value
- One of:
- Element named
<frequencies>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<frequencyModel normalize="true"> <hiddenNucleotides idref="hiddenNucleotides1"/> <frequencies> <duplicatedParameter idref="duplicatedParameter3"/> </frequencies> </frequencyModel>
<gammaDistributionModel> element
A model of a gamma distribution.
The element has the following contents:
- One of:
- One of:
Example:
<gammaDistributionModel> <shape> <diagonalMatrix idref="diagonalMatrix9"/> </shape> <scale> 1.0 </scale> </gammaDistributionModel>
<gammaPrior> element
Calculates the prior probability of some data under a given gamma distribution.
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<gammaPrior shape="1.0" scale="1.0" offset="1.0"> <nodeHeightsStatistic idref="nodeHeightsStatistic10"/> </gammaPrior>
<generalDataType> element
Defines a general DataType for any number of states
The element has the following contents:
- Identifiable elements (zero or more)
- <state code="X"/>*:<alias code="Y" state="X"/>*:<ambiguity code="Z" states="XY"/>
Example:
<!-- The XML for a nucleotide data type under this scheme would be --> <generalDataType id="nucleotides"> <state code="A"/> <state code="C"/> <state code="G"/> <state code="T"/> <alias code="U" state="T"/> <ambiguity code="R" states="AG"/> <ambiguity code="Y" states="CT"/> <ambiguity code="?" states="ACGT"/> <ambiguity code="-" states="ACGT"/> </generalDataType>
<generalizedSkylineGibbsOperator> element
This element returns a Gibbs operator for the joint distribution of population sizes.
The element takes following attributes:
- Attribute (optional)
linearis Boolean - Attribute
weightis Double - Attribute
loweris Double - Attribute
upperis Double - Attribute (optional)
Jeffreysis Boolean - Attribute (optional)
reverseis Boolean - Attribute (optional)
exponentialMarkovis Boolean - Attribute
shapeis Double
The element has the following contents:
- BayesianSkylineLikelihood element (exactly one)
- Parameter element (exactly one)
Example:
<generalizedSkylineGibbsOperator linear="true" weight="1.0" lower="1.0" upper="1.0" Jeffreys="true" reverse="true" exponentialMarkov="true" shape="1.0"> <generalizedSkyLineLikelihood idref="generalizedSkyLineLikelihood7"/> <diagonalMatrix idref="diagonalMatrix10"/> </generalizedSkylineGibbsOperator>
<generalizedSkyLineLikelihood> element
This element represents the likelihood of the tree given the population size vector.
The element has the following contents:
- Element named
<populationSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<groupSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<populationTree>containing:- TreeModel element (exactly one)
- TreeModel element (exactly one)
Example:
<generalizedSkyLineLikelihood type="foo"> <populationSizes> <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/> </populationSizes> <groupSizes> <parameter idref="parameter3"/> </groupSizes> <populationTree> <treeModel idref="treeModel10"/> </populationTree> </generalizedSkyLineLikelihood>
<generalizedSkylinePopSizeStatistic> element
The pop sizes at the given times
Example:
<generalizedSkylinePopSizeStatistic/>
<generalSubstitutionModel> element
A general reversible model of sequence substitution for any data type.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<rateIndicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<generalSubstitutionModel> <hiddenNucleotides idref="hiddenNucleotides1"/> <frequencies> <frequencyModel idref="frequencyModel1"/> </frequencies> <rates> <duplicatedParameter idref="duplicatedParameter7"/> </rates> </generalSubstitutionModel>
<GibbsPruneAndRegraft> element
This element represents a Gibbs sampler implemented through a prune and regraft operator. This operator prunes a random subtree and regrafts it below a node chosen by an importance distribution which is the proportion of the likelihoods of the proposals.
The element takes following attributes:
The element has the following contents:
- TreeModel element (exactly one)
Example:
<GibbsPruneAndRegraft weight="1.0" pruned="true"> <treeModel idref="treeModel2"/> </GibbsPruneAndRegraft>
<GibbsSubtreeSwap> element
This element represents a Gibbs wide exchange operator. This operator swaps two subtrees chosen to their posterior probaility.
The element takes following attributes:
The element has the following contents:
- TreeModel element (exactly one)
Example:
<GibbsSubtreeSwap weight="1.0" pruned="true"> <treeModel idref="treeModel4"/> </GibbsSubtreeSwap>
<glmModel> element
Calculates the generalized linear model likelihood of the dependent parameters given one or more blocks of independent parameters and their design matrix.
The element takes following attributes:
The element has the following contents:
- Element named
<dependentVariables>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<independentVariables>containing:- Parameter element (zero or one)
- DesignMatrix element (exactly one)
- Element named
<indicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Parameter element (zero or one)
- Element named
<randomEffects>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<glmModel family="foo" checkIdentifiability="true"> <independentVariables> <designMatrix idref="designMatrix9"/> </independentVariables> <independentVariables> <designMatrix idref="designMatrix5"/> </independentVariables> <randomEffects> <parameter idref="parameter8"/> </randomEffects> </glmModel>
<glmSubstitutionModel> element
A general model of sequence substitution for any data type where the rates come from the generalized linear model.
The element has the following contents:
- Element named
<rootFrequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- GeneralizedLinearModel element (exactly one)
Example:
<glmSubstitutionModel dataType="codon-euplotidNuclear"> <rootFrequencies> <frequencyModel idref="frequencyModel4"/> </rootFrequencies> <multivariateOUModel idref="multivariateOUModel7"/> </glmSubstitutionModel>
<gmrfBivariateCurveAnalysis> element
Integrates two curves
The element takes following attributes:
- Attribute
fileName1is String - Attribute
fileName2is String - Attribute
endTimeis String - Attribute (optional)
burnInis Integer
Example:
<gmrfBivariateCurveAnalysis fileName1="foo" fileName2="foo" endTime="foo" burnIn="1"/>
<gmrfBlockUpdateOperator> element
This element returns a GMRF block-update operator for the joint distribution of the population sizes and precision parameter.
The element takes following attributes:
- Attribute
scaleFactoris Double - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean - Attribute (optional)
stopValueis Double - Attribute (optional)
maxIterationsis Integer - Attribute (optional)
trialVersionis Boolean
The element has the following contents:
- GMRFSkyrideLikelihood element (exactly one)
Example:
<gmrfBlockUpdateOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" stopValue="1.0" maxIterations="1" trialVersion="true"> <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood3"/> </gmrfBlockUpdateOperator>
<gmrfFixedEffectsGibbsOperator> element
This element returns a Gibbs operator for regression coefficients in a GMRF.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- MultivariateDistributionLikelihood element (exactly one)
- Parameter element (exactly one)
- GMRFSkyrideLikelihood element (exactly one)
Example:
<gmrfFixedEffectsGibbsOperator weight="1.0"> <multivariateNormalPrior idref="multivariateNormalPrior7"/> <matrixParameter idref="matrixParameter5"/> <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood5"/> </gmrfFixedEffectsGibbsOperator>
<gmrfHeightsStatistic> element
A statistic that returns the heights of each internal node in increasing order (or groups them by a group size parameter)
The element takes following attributes:
- Attribute (optional)
nameis String
The element has the following contents:
- GMRFSkyrideLikelihood element (exactly one)
Example:
<gmrfHeightsStatistic name="foo"> <gmrfTestLikelihood idref="gmrfTestLikelihood5"/> </gmrfHeightsStatistic>
<gmrfPopSizeStatistic> element
The pop sizes at the given times
The element takes following attributes:
- Attribute (optional)
fromis Double - Attribute (optional)
tois Double - Attribute (optional)
numberis Integer - Attribute (optional)
timeis Double;
The element has the following contents:
- GMRFSkyrideLikelihood element (exactly one)
Example:
<gmrfPopSizeStatistic from="1.0" to="1.0" number="1" time="0.5 1.0"> <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood7"/> </gmrfPopSizeStatistic>
<gmrfSkyrideLikelihood> element
This element represents the likelihood of the tree given the population size vector.
The element takes following attributes:
- Attribute (optional)
rescaleByRootHeightis Boolean - Attribute (optional)
randomizeTreeis Boolean - Attribute (optional)
timeAwareSmoothingis Boolean
The element has the following contents:
- Element named
<populationSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<precisionParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<populationTree>containing:- TreeModel elements (one or more)
- TreeModel elements (one or more)
- Element named
<groupSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true"> <populationSizes> <compoundParameter idref="compoundParameter2"/> </populationSizes> <precisionParameter> <diagonalMatrix idref="diagonalMatrix3"/> </precisionParameter> <populationTree> <treeModel idref="treeModel4"/> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8"/> </populationTree> </gmrfSkyrideLikelihood>
<gmrfTestLikelihood> element
This element represents the likelihood of the tree given the population size vector.
The element has the following contents:
- Element named
<populationSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<precisionParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<lambdaParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<gmrfTestLikelihood> <populationSizes> <compoundParameter idref="compoundParameter2"/> </populationSizes> <precisionParameter> <compoundParameter idref="compoundParameter8"/> </precisionParameter> <lambdaParameter> <diagonalMatrix idref="diagonalMatrix2"/> </lambdaParameter> </gmrfTestLikelihood>
<greatCircleDiffusionModel> element
Describes a bivariate diffusion process using great circle distances.
The element has the following contents:
- Parameter element (exactly one)
- Element named
<diffusionCoefficient>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<greatCircleDiffusionModel> <parameter idref="parameter3"/> </greatCircleDiffusionModel>
<gtrCovarionModel> element
A covarion substitution model of langauge evolution with binary data and a hidden rate state with two rates.
The element has the following contents:
- Element named
<rateAC>containing:- Parameter element (exactly one)
- relative rate of A<->C substitution
- Parameter element (exactly one)
- Element named
<rateAG>containing:- Parameter element (exactly one)
- relative rate of A<->G substitution
- Parameter element (exactly one)
- Element named
<rateAT>containing:- Parameter element (exactly one)
- relative rate of A<->T substitution
- Parameter element (exactly one)
- Element named
<rateCG>containing:- Parameter element (exactly one)
- relative rate of C<->G substitution
- Parameter element (exactly one)
- Element named
<rateCT>containing:- Parameter element (exactly one)
- relative rate of C<->T substitution
- Parameter element (exactly one)
- Element named
<rateGT>containing:- Parameter element (exactly one)
- relative rate of G<->T substitution
- Parameter element (exactly one)
- Element named
<hiddenClassRates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<switchingRates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
Example:
<gtrCovarionModel> <hiddenClassRates> <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/> </hiddenClassRates> <switchingRates> <maskedParameter idref="maskedParameter2"/> </switchingRates> <frequencies> <frequencyModel idref="frequencyModel3"/> </frequencies> </gtrCovarionModel>
<gtrModel> element
A general reversible model of nucleotide sequence substitution.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<rateAC>containing:- Variable element (exactly one)
- Variable element (exactly one)
- Element named
<rateAG>containing:- Variable element (exactly one)
- Variable element (exactly one)
- Element named
<rateAT>containing:- Variable element (exactly one)
- Variable element (exactly one)
- Element named
<rateCG>containing:- Variable element (exactly one)
- Variable element (exactly one)
- Element named
<rateCT>containing:- Variable element (exactly one)
- Variable element (exactly one)
- Element named
<rateGT>containing:- Variable element (exactly one)
- Variable element (exactly one)
Example:
<!-- A general time reversible model for DNA. --> <!-- This element must have parameters for exactly five of the six rates --> <!-- The sixth rate has an implied value of 1.0 and all other rates are relative to it --> <!-- This example parameterizes the rate matrix relative to the A<->G transition --> <gtrModel id="gtr1"> <frequencies> <frequencyModel idref="freqs"/> </frequencies> <rateAC> <parameter id="rateAC" value="1.0"/> </rateAC> <rateAT> <parameter id="rateAT" value="1.0"/> </rateAT> <rateCG> <parameter id="rateCG" value="1.0"/> </rateCG> <rateCT> <parameter id="rateCT" value="1.0"/> </rateCT> <rateGT> <parameter id="rateGT" value="1.0"/> </rateGT> </gtrModel>
<hiddenNucleotides> element
A nucleotide data type that allows hidden substitution classes
The element takes following attributes:
- Attribute
classCountis Integer
Example:
<hiddenNucleotides classCount="1"/>
<hierarchicalPartitionLikelihood> element
null
The element has the following contents:
- ARGModel element (exactly one)
Example:
<hierarchicalPartitionLikelihood> <argTreeModel idref="argTreeModel3"/> </hierarchicalPartitionLikelihood>
<HKYModel> element
This element represents an instance of the HKY85 (Hasegawa, Kishino & Yano, 1985) model of nucleotide evolution.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<kappa>containing:- Variable element (exactly one)
- Variable element (exactly one)
Example:
<HKYModel> <frequencies> <frequencyModel idref="frequencyModel7"/> </frequencies> <kappa> <compoundParameter idref="compoundParameter10"/> </kappa> </HKYModel>
<hypermutantAlignment> element
Converts an alignment so that 'A's at specific APOBEC targeted contexts are set to an A/G ambiguity code.
The element takes following attributes:
- Attribute
typeis String- The type of APOBEC molecule being modelled
The element has the following contents:
- Alignment element (exactly one)
Example:
<hypermutantAlignment type="hA3G"> <convert idref="convert4"/> </hypermutantAlignment>
<hypermutantErrorModel> element
This element returns a model that allows for APOBEC-type RNA editing.
The element takes following attributes:
- Attribute (optional)
unlinkedRatesis Boolean
The element has the following contents:
- HypermutantAlignment element (exactly one)
- Element named
<hypermutationRate>containing:- Parameter element (exactly one)
- The hypermutation rate per target site per sequence
- Parameter element (exactly one)
- Element named
<hypermutationIndicators>containing:- Parameter element (exactly one)
- A binary indicator of whether the sequence is hypermutated
- Parameter element (exactly one)
Example:
<hypermutantErrorModel unlinkedRates="true"> ERROR! <hypermutationRate> <compoundParameter idref="compoundParameter3"/> </hypermutationRate> <hypermutationIndicators> <diagonalMatrix idref="diagonalMatrix4"/> </hypermutationIndicators> </hypermutantErrorModel>
<ibdReporter> element
This element represents a reporter for expected number of tips ibd.
The element has the following contents:
- TreeModel element (exactly one)
- BranchRateModel element (zero or one)
- AbstractSubstitutionModel element (exactly one)
- Parameter element (exactly one)
Example:
<ibdReporter> <treeModel idref="treeModel4"/> <lewisMk idref="lewisMk5"/> <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/> </ibdReporter>
<ImportanceNarrowExchange> element
This element represents a swap operator. This operator swaps a random subtree with its uncle.
The element takes following attributes:
The element has the following contents:
- PatternList element (exactly one)
- TreeModel element (exactly one)
Example:
<ImportanceNarrowExchange weight="1.0" epsilon="1.0"> <ascertainedPatterns idref="ascertainedPatterns6"/> <treeModel idref="treeModel5"/> </ImportanceNarrowExchange>
<ImportancePruneAndRegraft> element
This element represents a importance guided prune and regraft operator. This operator prunes a random subtree and regrafts it below a node chosen by an importance distribution.
The element takes following attributes:
The element has the following contents:
- TreeModel element (exactly one)
Example:
<ImportancePruneAndRegraft weight="1.0" samples="1"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel9"/> </ImportancePruneAndRegraft>
<ImportanceSubtreeSwap> element
This element represents a importance guided subtree swap operator. This operator swaps a random subtree with a second subtree guided by an importance distribution.
The element takes following attributes:
The element has the following contents:
- TreeModel element (exactly one)
Example:
<ImportanceSubtreeSwap weight="1.0" samples="1"> <treeModel idref="treeModel2"/> </ImportanceSubtreeSwap>
<inhibitionLikelihood> element
Provides the likelihood of a continuous trait evolving on a tree by a given diffusion model.
The element has the following contents:
- TreeModel element (exactly one)
- MatrixParameter element (exactly one)
- Element named
<precision>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<inhibitionLikelihood> <treeModel idref="treeModel10"/> <compoundSymmetricMatrix idref="compoundSymmetricMatrix8"/> <precision> <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/> </precision> </inhibitionLikelihood>
<integer> element
returns an Integer. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as an Integer.
The element has the following contents:
- One of:
Example:
<integer> 1 </integer>
<traitGibbsOperator> element
This element returns a multivariate Gibbs operator on traits for possible all nodes.
The element takes following attributes:
- Attribute
weightis Double - Attribute (optional)
onlyInternalNodesis Boolean - Attribute (optional)
onlyTipsWithPriorsis Boolean
The element has the following contents:
- SampledMultivariateTraitLikelihood element (exactly one)
- MultivariateDistributionLikelihood elements (zero or more)
- Element named
<rootPrior>containing:- MultivariateDistributionLikelihood element (exactly one)
- MultivariateDistributionLikelihood element (exactly one)
- GeoSpatialCollectionModel element (zero or one)
Example:
<traitGibbsOperator weight="1.0" onlyInternalNodes="true" onlyTipsWithPriors="true"> ERROR! </traitGibbsOperator>
<invgammaPrior> element
Calculates the prior probability of some data under a given inverse gamma distribution.
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<invgammaPrior shape="1.0" scale="1.0" offset="1.0"> <exponentialStatistic idref="exponentialStatistic1"/> <gmrfHeightsStatistic idref="gmrfHeightsStatistic3"/> </invgammaPrior>
<inverseGaussianDistributionModel> element
Describes a inverse gaussian distribution with a given mean and shape (or standard deviation) that can be used in a distributionLikelihood element
The element takes following attributes:
- Attribute (optional)
offsetis Double
The element has the following contents:
- Element named
<mean>containing:
- Element named
<stdev>containing:
- Element named
<shape>containing:
Example:
<inverseGaussianDistributionModel offset="1.0"> <mean> <diagonalMatrix idref="diagonalMatrix1"/> </mean> </inverseGaussianDistributionModel>
<invgammaPrior> element
Calculates the prior probability of some data under a given inverse gamma distribution.
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<invgammaPrior shape="1.0" scale="1.0" offset="1.0"> <speciesTreeStatistic idref="speciesTreeStatistic6"/> <statistic idref="statistic8"/> <monophylyStatistic idref="monophylyStatistic8"/> <maskedParameter idref="maskedParameter4"/> </invgammaPrior>
<oneOnXPrior> element
Calculates the (improper) prior proportional to Prod_i (1/x_i) for the given statistic x.
The element has the following contents:
- One of:
Example:
<oneOnXPrior> <data> <matrixParameter idref="matrixParameter2"/> <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/> <test idref="test5"/> </data> </oneOnXPrior>
<jointOperator> element
This element represents an arbitrary list of operators; only the first is optimizable
The element takes following attributes:
The element has the following contents:
- SimpleMCMCOperator elements (one or more)
Example:
<jointOperator weight="1.0" targetAcceptance="1.0"> <argSubtreeSlide idref="argSubtreeSlide7"/> <jointOperator idref="jointOperator8"/> <argPartitionOperator idref="argPartitionOperator7"/> </jointOperator>
<kStateType> element
Parser for k-state model.
The element takes following attributes:
Example:
<kStateType stateCount="1" startWith="1"/>
<laplacePrior> element
Calculates the prior probability of some data under a given laplace distribution.
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<laplacePrior mean="1.0" stdev="1.0"> <reciprocalStatistic idref="reciprocalStatistic8"/> <correlation idref="correlation3"/> <designMatrix idref="designMatrix6"/> <treeMetricStatistic idref="treeMetricStatistic10"/> </laplacePrior>
<lewisMk> element
A parser for Lewis' Mk model
The element takes following attributes:
- Attribute (optional)
totalOrderis Boolean
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<order>containing:
Example:
<lewisMk totalOrder="true"> <frequencies> <frequencyModel idref="frequencyModel5"/> </frequencies> </lewisMk>
<compoundLikelihood> element
A likelihood function which is simply the product of its component likelihood functions.
The element takes following attributes:
- Attribute (optional)
threadsis Integer
The element has the following contents:
- Likelihood elements (one or more)
Example:
<compoundLikelihood threads="1"> <arbitraryBranchRates idref="arbitraryBranchRates8"/> </compoundLikelihood>
<lineageCountStatistic> element
The element has the following contents:
- OldAbstractCoalescentLikelihood element (exactly one)
Example:
<lineageCountStatistic> <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood10"/> </lineageCountStatistic>
<LINEARBIASModel> element
This element represents an instance of the stepwise mutation model of microsatellite evolution.
The element takes following attributes:
- Attribute (optional)
estimateSubmodelParametersis String- whether or not to esitmate the parameters of the submodel
- Attribute (optional)
logisticsis Boolean - Attribute (optional)
isSubmodelis Boolean
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<Submodel>containing:- OnePhaseModel element (exactly one)
- OnePhaseModel element (exactly one)
- Microsatellite element (exactly one)
- Element named
<BiasConstant>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<BiasLinear>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<LINEARBIASModel estimateSubmodelParameters="foo" logistics="true" isSubmodel="true"> <Submodel> <LINEARBIASModel idref="LINEARBIASModel8"/> </Submodel> <microsatellite idref="microsatellite10"/> </LINEARBIASModel>
<localClockModel> element
This element returns a branch rate model that adds a delta to each terminal branch length.
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<rate>containing:- Parameter element (exactly one)
- The molecular evolutionary rate parameter
- Parameter element (exactly one)
- Element named
<externalBranches>containing: - Element named
<clade>containing:- Attribute (optional)
relativeis Boolean - Attribute (optional)
includeStemis Boolean- determines whether or not the stem branch above this clade is included in the siteModel (default false).
- Attribute (optional)
excludeCladeis Boolean- determines whether to exclude actual branches of the clade from the siteModel (default false).
- Taxa element (exactly one)
- A set of taxa which defines a clade to apply a different site model to
- Parameter element (exactly one)
- The rate parameter
- Attribute (optional)
- Element named
<backbone>containing:
Example:
<localClockModel> <treeModel idref="treeModel2"/> <rate> <matrixParameter idref="matrixParameter9"/> </rate> <backbone relative="true"> <taxa idref="taxa2"/> <matrixParameter idref="matrixParameter7"/> </backbone> <backbone relative="true"> <taxa idref="taxa4"/> <designMatrix idref="designMatrix5"/> </backbone> </localClockModel>
<location> element
Specifies a location with an optional longitude and latitude
The element takes following attributes:
- Attribute (optional)
descriptionis String- A description of this location
- Attribute (optional)
longitudeis String- The longitude in degrees, minutes, seconds or decimal degrees
- Attribute (optional)
latitudeis String- The latitude in degrees, minutes, seconds or decimal degrees
Example:
<location description="foo" longitude="foo" latitude="foo"/>
<log> element
Logs one or more items at a given frequency to the screen or to a file
The element takes following attributes:
- Attribute
logEveryis Integer - Attribute (optional)
overwriteis Boolean - Attribute (optional)
fileNameis String- The name of the file to send log output to. If no file name is specified then log is sent to standard output
- Attribute (optional)
titleis String- The title of the log
The element has the following contents:
- At least one of:**Columns elements (one or more)
Example:
<log logEvery="1" overwrite="true" fileName="foo" title="foo"> <column idref="column7"/> <column idref="column10"/> <column idref="column8"/> <column idref="column9"/> </log>
<logAllTraits> element
null
The element has the following contents:
- TreeModel element (exactly one)
- The tree which is to be logged
Example:
<logAllTraits> <treeModel idref="treeModel9"/> </logAllTraits>
<logArg> element
Logs an ARG to a file
The element takes following attributes:
- Attribute
logEveryis Integer - Attribute
formatis String- The type logger's output type
- Attribute (optional)
fileNameis String- The name of the file to send log output to. If no file name is specified then log is sent to standard output
- Attribute (optional)
titleis String- The title of the log
The element has the following contents:
- ARGModel element (exactly one)
- The ARG which is to be logged
Example:
<!-- The logArg element takes an argModel to be logged --> <logArg logEvery="100" fileName="log.args"> <argModel idref="treeModel1"/> </logArg>
<logArgTree> element
Logs a tree to a file
The element takes following attributes:
- Attribute
logEveryis Integer - Attribute
partitionis Integer - Attribute (optional)
fileNameis String- The name of the file to send log output to. If no file name is specified then log is sent to standard output
- Attribute (optional)
titleis String- The title of the log
- Attribute (optional)
nexusFormatis Boolean- Whether to use the NEXUS format for the tree log
- Attribute (optional)
branchLengthsis String- What units should the branch lengths be in
The element has the following contents:
- ARGModel element (exactly one)
- The ARG which is to be logged
- BranchRateModel element (zero or one)
- ColourSamplerModel element (zero or one)
- Likelihood element (zero or one)
Example:
<!-- The logArgTree element takes an argTreeModel to be logged --> <logArgTree logEvery="100" fileName="log.trees" nexusFormat="true"> <treeModel idref="treeModel1"/> </logArgTree>
<logarithmStatistic> element
This element returns a statistic that is the element-wise natural logarithm of the child statistic.
The element takes following attributes:
- Attribute (optional)
baseis Double- An optional base for the logarithm (default is the natural logarithm, base e)
The element has the following contents:
- Statistic element (exactly one)
Example:
<logarithmStatistic base="1.0"> <compatibilityStatistic idref="compatibilityStatistic2"/> </logarithmStatistic>
<logarithmStatistic> element
This element returns a statistic that is the element-wise natural logarithm of the child statistic.
The element takes following attributes:
- Attribute (optional)
baseis Double- An optional base for the logarithm (default is the natural logarithm, base e)
The element has the following contents:
- Statistic element (exactly one)
Example:
<logarithmStatistic base="1.0"> <nodeHeightsStatistic idref="nodeHeightsStatistic8"/> </logarithmStatistic>
<logFileTrace> element
reconstruct population graph from variable dimension run.
The element takes following attributes:
- Attribute
fileNameis String- trace log.
- Attribute (optional)
burnInis Integer- The number of states (not sampled states, but actual states) that are discarded from the beginning of the trace before doing the analysis
Example:
<logFileTrace fileName="foo" burnIn="1"/>
<loggableStatistic> element
Allows you to choose specific dimensions of a given statistic
The element has the following contents:
- Loggable element (exactly one)
Example:
<loggableStatistic> <parsimonyStatistic idref="parsimonyStatistic3"/> </loggableStatistic>
<logisticGrowth> element
Logistic growth demographic model.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<populationSize>containing:- Parameter element (exactly one)
- This parameter represents the carrying capacity (maximum population size). If the shape is very large then the current day population size will be very close to the carrying capacity.
- Parameter element (exactly one)
- One of:
- Element named
<growthRate>containing:- Parameter element (exactly one)
- This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.
- Parameter element (exactly one)
- Element named
<doublingTime>containing:- Parameter element (exactly one)
- This parameter determines the doubling time at peak growth rate.
- Parameter element (exactly one)
- Element named
- Element named
<t50>containing:- Parameter element (exactly one)
- This parameter represents the time in the past when the population had half of the carrying capacity (population size). It is therefore a positive number with the same units as divergence times. A scale operator is recommended with a starting value near zero. A lower bound of zero should be employed and an upper bound is required!
- Parameter element (exactly one)
Example:
<logisticGrowth units="substitutions"> <populationSize> <designMatrix idref="designMatrix10"/> </populationSize> <doublingTime> <designMatrix idref="designMatrix2"/> </doublingTime> <t50> <maskedParameter idref="maskedParameter5"/> </t50> </logisticGrowth>
<logML> element
Logs one or more items every time the given likelihood improves
The element takes following attributes:
- Attribute (optional)
logEveryis Integer
The element has the following contents:
- Element named
<ml>containing:- Likelihood element (exactly one)
- Likelihood element (exactly one)
- At least one of:**Columns elements (one or more)
- Loggable elements (one or more)
Example:
<logML logEvery="1"> <ml> <ovariableSkyLineLikelihood idref="ovariableSkyLineLikelihood4"/> </ml> <column idref="column3"/> <column idref="column4"/> </logML>
<logNormalDistributionModel> element
Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element
The element takes following attributes:
The element has the following contents:
- Element named
<mean>containing:
- One of:
Example:
<logNormalDistributionModel meanInRealSpace="true" offset="1.0"> <mean> 1.0 </mean> <precision> <diagonalMatrix idref="diagonalMatrix7"/> </precision> </logNormalDistributionModel>
<logNormalPrior> element
Calculates the prior probability of some data under a given lognormal distribution.
The element takes following attributes:
- Attribute
meanis Double - Attribute
stdevis Double - Attribute (optional)
offsetis Double - Attribute (optional)
meanInRealSpaceis Boolean
The element has the following contents:
- Statistic elements (one or more)
Example:
<logNormalPrior mean="1.0" stdev="1.0" offset="1.0" meanInRealSpace="true"> <rateCovarianceStatistic idref="rateCovarianceStatistic1"/> <lineageCountStatistic idref="lineageCountStatistic1"/> <speciesTreeStatistic idref="speciesTreeStatistic3"/> <expressionStatistic idref="expressionStatistic1"/> </logNormalPrior>
<logRandomWalkOperator> element
This element returns a scale operator on a given parameter.
The element takes following attributes:
- Attribute
windowis Double - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean - Attribute (optional)
scaleAllis Boolean - Attribute (optional)
scaleAllIndependentlyis Boolean
The element has the following contents:
- Parameter element (exactly one)
Example:
<logRandomWalkOperator window="1.0" weight="1.0" autoOptimize="true" scaleAll="true" scaleAllIndependently="true"> <parameter idref="parameter7"/> </logRandomWalkOperator>
<logTree> element
Logs a tree to a file
The element takes following attributes:
- Attribute (optional)
logEveryis Integer - Attribute (optional)
overwriteis Boolean - Attribute (optional)
fileNameis String- The name of the file to send log output to. If no file name is specified then log is sent to standard output
- Attribute (optional)
titleis String- The title of the log
- Attribute (optional)
nexusFormatis Boolean- Whether to use the NEXUS format for the tree log
- Attribute (optional)
sortTranslationTableis Boolean- Whether the translation table is sorted.
- Attribute (optional)
branchLengthsis String- What units should the branch lengths be in
- Attribute (optional)
mapNamesToNumbersis Boolean - Attribute (optional)
dpis Integer
The element has the following contents:
- Tree element (exactly one)
- The tree which is to be logged
- BranchRates element (zero or one)
- TreeColouringProvider element (zero or one)
- Likelihood element (zero or one)
- TreeAttributeProvider elements (zero or more)
- TreeTraitProvider elements (zero or more)
- TreeLogger$LogUpon element (zero or one)
Example:
<!-- The logTree element takes a treeModel to be logged --> <logTree logEvery="100" fileName="log.trees" nexusFormat="true"> <treeModel idref="treeModel1"/> </logTree>
<marginalLikelihoodAnalysis> element
Performs a trace analysis. Estimates the mean of the various statistics in the given log file.
The element takes following attributes:
- Attribute
fileNameis String- The traceName of a BEAST log file (can not include trees, which should be logged separately
- Attribute (optional)
burnInis Integer
The element has the following contents:
- Element named
<likelihoodColumn>containing:- Attribute
nameis String- The column name
- Attribute
Example:
<marginalLikelihoodAnalysis fileName="foo" burnIn="1"> <likelihoodColumn name="foo"/> </marginalLikelihoodAnalysis>
<ancestralTreeLikelihood> element
This element represents the likelihood of a patternlist on a tree given the site model.
The element takes following attributes:
- Attribute (optional)
useAmbiguitiesis Boolean - Attribute (optional)
storePartialsis Boolean - Attribute (optional)
tagNameis String - Attribute (optional)
forceRescalingis Boolean - Attribute (optional)
useMAPis Boolean - Attribute (optional)
useMarginalLikelihoodis Boolean
The element has the following contents:
- PatternList element (exactly one)
- TreeModel element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (zero or one)
- SubstitutionModel element (exactly one)
Example:
<ancestralTreeLikelihood useAmbiguities="true" storePartials="true" tagName="foo" forceRescaling="true" useMAP="true" useMarginalLikelihood="true"> <sequenceSimulator idref="sequenceSimulator8"/> <treeModel idref="treeModel3"/> <DirichletSiteModel idref="DirichletSiteModel9"/> <aminoAcidModel idref="aminoAcidModel2"/> </ancestralTreeLikelihood>
<maskedParameter> element
A masked parameter.
The element takes following attributes:
- Attribute (optional)
complementis Boolean
The element has the following contents:
Example:
<maskedParameter complement="true"> <maskedParameter idref="maskedParameter9"/> <mask> <designMatrix idref="designMatrix10"/> </mask> </maskedParameter>
<matrixParameter> element
A matrix parameter constructed from its component parameters.
The element has the following contents:
- Parameter elements (one or more)
Example:
<matrixParameter> <compoundSymmetricMatrix idref="compoundSymmetricMatrix4"/> </matrixParameter>
<mcmc> element
This element returns an MCMC chain and runs the chain as a side effect.
The element takes following attributes:
- Attribute
chainLengthis Integer - Attribute (optional)
autoOptimizeis Boolean - Attribute (optional)
autoOptimizeDelayis Integer - Attribute (optional)
preBurninis Integer - Attribute (optional)
temperatureis Double - Attribute (optional)
fullEvaluationis Integer - Attribute (optional)
minOpsFullEvaluationsis Integer - Attribute (optional)
spawnis Boolean - Attribute (optional)
nameis String - Attribute (optional)
operatorAnalysisis String
The element has the following contents:
- OperatorSchedule element (exactly one)
- Likelihood element (exactly one)
- Logger elements (one or more)
Example:
<mcmc chainLength="1" autoOptimize="true" autoOptimizeDelay="1" preBurnin="1" temperature="1.0" fullEvaluation="1" minOpsFullEvaluations="1" spawn="true" name="foo" operatorAnalysis="foo"> <operators idref="operators9"/> <booleanLikelihood idref="booleanLikelihood8"/> <log idref="log4"/> </mcmc>
<meanStatistic> element
This element returns a statistic that is the mean of the child statistics.
The element has the following contents:
- Statistic elements (one or more)
Example:
<meanStatistic> <meanStatistic idref="meanStatistic9"/> <notStatistic idref="notStatistic8"/> <treeLengthStatistic idref="treeLengthStatistic7"/> </meanStatistic>
<mergePatterns> element
A weighted list of the unique site patterns (unique columns) in an alignment.
The element has the following contents:
- SiteList elements (one or more)
Example:
<mergePatterns> <convert idref="convert2"/> <hypermutantAlignment idref="hypermutantAlignment9"/> </mergePatterns>
<microsatellite> element
This element represents a microsatellite data type.
The element has the following contents:
Example:
<microsatellite min="0" max="20" unitLength="2"/>
<microsatellitePattern> element
This element represents a microsatellite pattern.
The element takes following attributes:
- Attribute
idis String- the name of the locus
- Attribute (optional)
printDetailsis Boolean - Attribute (optional)
printMsatPatContentis Boolean
The element has the following contents:
- Taxa element (exactly one)
- Microsatellite element (exactly one)
- Element named
<microsatSeq>containing:- String element (exactly one)
- A string of numbers representing the microsatellite lengths for a locus
- String element (exactly one)
Example:
<microsatellitePattern id="foo" printDetails="true" printMsatPatContent="true"> <taxa idref="taxa9"/> <microsatellite idref="microsatellite7"/> <microsatSeq> 1,2,3,4,5,67,100 </microsatSeq> </microsatellitePattern>
<microsatelliteSamplerTreeLikelihood> element
this parser returns an object of the TreeMicrosatelliteSamplerLikelihood class
The element has the following contents:
- MicrosatelliteSamplerTreeModel element (exactly one)
- MicrosatelliteModel element (exactly one)
- Element named
<mutationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- BranchRateModel element (zero or one)
Example:
<microsatelliteSamplerTreeLikelihood> <microsatelliteSamplerTreeModel idref="microsatelliteSamplerTreeModel9"/> <LINEARBIASModel idref="LINEARBIASModel8"/> </microsatelliteSamplerTreeLikelihood>
<microsatelliteSamplerTreeModel> element
This parser returns a TreeMicrosatelliteSamplerModel Object
The element takes following attributes:
- Attribute (optional)
provideInternalNodeValuesis Boolean
The element has the following contents:
- Element named
<tree>containing:- TreeModel element (exactly one)
- TreeModel element (exactly one)
- Element named
<internalValues>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<externalValues>containing:- Patterns element (exactly one)
- Patterns element (exactly one)
Example:
<microsatelliteSamplerTreeModel provideInternalNodeValues="true"> <tree> <treeModel idref="treeModel10"/> </tree> <internalValues> <matrixParameter idref="matrixParameter5"/> </internalValues> <externalValues> <microsatellitePattern idref="microsatellitePattern10"/> </externalValues> </microsatelliteSamplerTreeModel>
<microsatelliteSimulator> element
This parser facilliates simulation of microsatellites given a tree and infinitesimal rate model
The element has the following contents:
- Microsatellite element (exactly one)
- Taxa element (exactly one)
- Tree element (exactly one)
- MicrosatelliteModel element (exactly one)
- BranchRateModel element (zero or one)
Example:
<microsatelliteSimulator> <microsatellite idref="microsatellite2"/> <taxa idref="taxa4"/> <neighborJoiningTree idref="neighborJoiningTree6"/> <LINEARBIASModel idref="LINEARBIASModel3"/> </microsatelliteSimulator>
<microsatUpDownOperator> element
This element represents an operator that scales two parameters in different directions. Each operation involves selecting a scale uniformly at random between scaleFactor and 1/scaleFactor. The up parameter is multipled by this scale and the down parameter is divided by this scale.
The element takes following attributes:
- Attribute
scaleFactoris Double - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- Element named
<up>containing:- Parameter element (zero or one)
- Parameter element (zero or one)
- Element named
<down>containing:- Parameter element (zero or one)
- Parameter element (zero or one)
Example:
<microsatUpDownOperator scaleFactor="1.0" weight="1.0" autoOptimize="true"> <up/> <up/> <down/> <down/> <down/> </microsatUpDownOperator>
<mixedDistributionLikelihood> element
Calculates the likelihood of some data given some mix of parametric distributions.
The element has the following contents:
- Element named
<distribution0>containing:- ParametricDistributionModel element (exactly one)
- ParametricDistributionModel element (exactly one)
- Element named
<distribution1>containing:- ParametricDistributionModel element (exactly one)
- ParametricDistributionModel element (exactly one)
- Element named
<data>containing:- Statistic element (exactly one)
- Statistic element (exactly one)
- Element named
<indicators>containing:- Statistic element (exactly one)
- Statistic element (exactly one)
Example:
<mixedDistributionLikelihood> <distribution0> <gammaDistributionModel idref="gammaDistributionModel9"/> </distribution0> <distribution1> <normalDistributionModel idref="normalDistributionModel5"/> </distribution1> <data> <gmrfHeightsStatistic idref="gmrfHeightsStatistic6"/> </data> <indicators> <monotonicStatistic idref="monotonicStatistic9"/> </indicators> </mixedDistributionLikelihood>
<mixtureCartogramDiffusionModel> element
Describes a bivariate diffusion process using cartogram distances.
The element has the following contents:
- Parameter element (exactly one)
- Element named
<mixture>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<boundingBox>containing:
Example:
<mixtureCartogramDiffusionModel> <maskedParameter idref="maskedParameter7"/> <mixture> <maskedParameter idref="maskedParameter6"/> </mixture> <boundingBox minX="1.0" maxX="1.0" minY="1.0" maxY="1.0"/> </mixtureCartogramDiffusionModel>
<mixtureModel> element
This element represents a discrete mixture of tree likelihood models.
The element takes following attributes:
- Attribute (optional)
normalizeis Boolean
The element has the following contents:
- Likelihood elements ( or more)
- Parameter element (exactly one)
Example:
<mixtureModel normalize="true"> <cachedPrior idref="cachedPrior7"/> <dirichletPrior idref="dirichletPrior1"/> <diagonalMatrix idref="diagonalMatrix7"/> </mixtureModel>
<mixtureModelBranchRates> element
This element returns a random discretized relaxed clock model.The branch rates are drawn from a continuous parametric distribution.
The element takes following attributes:
- Attribute (optional)
singleRootRateis Boolean- Whether only a single rate should be used for the two children branches of the root
- Attribute (optional)
normalizeis Boolean- Whether the mean rate has to be normalized to a particular value
- Attribute (optional)
normalizeBranchRateTois Double- The mean rate to normalize to, if normalizing
- Attribute (optional)
useQuantilesForRatesis Boolean- Whether or not to use quantiles to represent rates. If false then rates are not drawn specifically from any of the distributions
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<distribution>containing:- ParametricDistributionModel element (exactly one)
- The distribution model for rates among branches
- ParametricDistributionModel element (exactly one)
- Element named
<distributionIndex>containing:- Parameter element (exactly one)
- Operator that switches between the distributions of the branch rate distribution model
- Parameter element (exactly one)
- Element named
<rateCategoryQuantiles>containing:- Parameter element (exactly one)
- The quantiles for
- Parameter element (exactly one)
Example:
<mixtureModelBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0" useQuantilesForRates="true"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6"/> <distribution> <uniformDistributionModel idref="uniformDistributionModel6"/> </distribution> <distribution> <uniformDistributionModel idref="uniformDistributionModel9"/> </distribution> <distribution> <uniformDistributionModel idref="uniformDistributionModel4"/> </distribution> <distributionIndex> <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/> </distributionIndex> <rateCategoryQuantiles> <designMatrix idref="designMatrix2"/> </rateCategoryQuantiles> </mixtureModelBranchRates>
<mkSubstitutionModel> element
An Mk model of substitution. This model can also accomodate arbitrary orderings of changes.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
Example:
<mkSubstitutionModel> <frequencies> <frequencyModel idref="frequencyModel7"/> </frequencies> </mkSubstitutionModel>
<modelSpecificPseudoPrior> element
Calculates the likelihood of some data given some parametric or empirical distribution.
Example:
<modelSpecificPseudoPrior/>
<monophylyStatistic> element
A statistic that returns true if a given set of taxa are monophyletic for a given tree
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic for the purpose of logging
The element has the following contents:
- Tree element (exactly one)
- Element named
<mrca>containing:
- An optional list of taxa to ignore from the test of monophyly
Example:
<monophylyStatistic name="foo"> <newick idref="newick1"/> <mrca> <taxon idref="taxon9"/> </mrca> </monophylyStatistic>
<monotonicStatistic> element
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<monotonicStatistic order="foo" strictlyMonotic="true"> <loggableStatistic idref="loggableStatistic6"/> <differenceStatistic idref="differenceStatistic7"/> <monotonicStatistic idref="monotonicStatistic10"/> <expressionStatistic idref="expressionStatistic8"/> </monotonicStatistic>
<mrcaTraitStatistic> element
A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
- Attribute
traitis String- The name of the trait (can be rate)
- Attribute (optional)
rateis Boolean
The element has the following contents:
Example:
<mrcaTraitStatistic name="foo" trait="foo" rate="true"> <treeModel idref="treeModel5"/> <mrca> <taxa idref="taxa2"/> </mrca> </mrcaTraitStatistic>
<msatAvgSubsetModel> element
This element represents an instance of the Microsatellite Averaging Model of microsatellite evolution.
The element takes following attributes:
- Attribute (optional)
logitis Boolean
The element has the following contents:
- Microsatellite element (exactly one)
- Element named
<models>containing: - Element named
<rateProps>containing: - Element named
<biasConsts>containing: - Element named
<biasLins>containing: - Element named
<geos>containing: - Element named
<modelChoose>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<modelIndicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<msatAvgSubsetModel logit="true">
<microsatellite idref="microsatellite3"/>
<models>
<model binary="foo" code="foo"/>
<model binary="foo" code="foo"/>
</models>
<rateProps>
<rateProp inModels="1 2 4 8">
<diagonalMatrix idref="diagonalMatrix8"/>
</rateProp>
<rateProp inModels="1 2 4 8">
<designMatrix idref="designMatrix7"/>
</rateProp>
<rateProp inModels="1 2 4 8">
<maskedParameter idref="maskedParameter10"/>
</rateProp>
</rateProps>
<biasConsts>
<biasConst inModels="1 2 4 8">
<designMatrix idref="designMatrix5"/>
</biasConst>
<biasConst inModels="1 2 4 8">
<designMatrix idref="designMatrix6"/>
</biasConst>
<biasConst inModels="1 2 4 8">
<matrixParameter idref="matrixParameter8"/>
</biasConst>
</biasConsts>
<biasLins>
<biasLin inModels="1 2 4 8">
<maskedParameter idref="maskedParameter1"/>
</biasLin>
</biasLins>
<geos>
<geo inModels="1 2 4 8">
<matrixParameter idref="matrixParameter10"/>
</geo>
<geo inModels="1 2 4 8">
<compoundSymmetricMatrix idref="compoundSymmetricMatrix5"/>
</geo>
</geos>
<modelChoose>
<maskedParameter idref="maskedParameter7"/>
</modelChoose>
<modelIndicator>
<duplicatedParameter idref="duplicatedParameter3"/>
</modelIndicator>
</msatAvgSubsetModel>
<msatModelSelectOperator> element
This element returns a microsatellite averaging operator on a given parameter.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Element named
<modelChoose>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<modelIndicators>containing:- Parameter elements (one or more)
- Parameter elements (one or more)
Example:
<msatModelSelectOperator weight="1.0"> <modelChoose> <matrixParameter idref="matrixParameter2"/> </modelChoose> <modelIndicators> <duplicatedParameter idref="duplicatedParameter7"/> <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/> </modelIndicators> </msatModelSelectOperator>
<msatModelSwitchOperator> element
This element returns a microsatellite averaging operator on a given parameter.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Element named
<modelChoose>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<dependencies>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<msatModelSwitchOperator weight="1.0"> <modelChoose> <diagonalMatrix idref="diagonalMatrix8"/> </modelChoose> <dependencies> <designMatrix idref="designMatrix8"/> </dependencies> </msatModelSwitchOperator>
<multiLociDistance> element
Constructs a distance matrix from a pattern list or alignment
The element has the following contents:
- DistanceMatrix elements (one or more)
Example:
<multiLociDistance> <distanceMatrix idref="distanceMatrix7"/> <distanceMatrix idref="distanceMatrix6"/> </multiLociDistance>
<multivariateDiffusionModel> element
Describes a multivariate normal diffusion process.
The element has the following contents:
- Element named
<precisionMatrix>containing:- MatrixParameter element (exactly one)
- MatrixParameter element (exactly one)
Example:
<multivariateDiffusionModel> <precisionMatrix> <matrixParameter idref="matrixParameter5"/> </precisionMatrix> </multivariateDiffusionModel>
<multivariateGammaPrior> element
Calculates the likelihood of some data under a given multivariate-gamma distribution.
The element has the following contents:
- One of:
- One of:
- Element named
<data>containing:- Parameter elements (one or more)
- Parameter elements (one or more)
Example:
<multivariateGammaPrior> <meanParameter> <compoundParameter idref="compoundParameter10"/> </meanParameter> <coefficientOfVariation> <designMatrix idref="designMatrix10"/> </coefficientOfVariation> <data> <compoundParameter idref="compoundParameter4"/> <compoundParameter idref="compoundParameter6"/> <duplicatedParameter idref="duplicatedParameter4"/> </data> </multivariateGammaPrior>
<multivariateInverseWishartPrior> element
Calculates the likelihood of some data under an Inverse-Wishart distribution.
The element takes following attributes:
- Attribute
dfis Double
The element has the following contents:
- Element named
<scaleMatrix>containing:- MatrixParameter element (exactly one)
- MatrixParameter element (exactly one)
Example:
<multivariateInverseWishartPrior df="1.0"> <scaleMatrix> <diagonalMatrix idref="diagonalMatrix9"/> </scaleMatrix> </multivariateInverseWishartPrior>
<multivariateNormalPrior> element
Calculates the likelihood of some data under a given multivariate-normal distribution.
The element has the following contents:
- Element named
<meanParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<precisionParameter>containing:- MatrixParameter element (exactly one)
- MatrixParameter element (exactly one)
- Element named
<data>containing:- Parameter elements (one or more)
- Parameter elements (one or more)
Example:
<multivariateNormalPrior> <meanParameter> <maskedParameter idref="maskedParameter1"/> </meanParameter> <precisionParameter> <compoundSymmetricMatrix idref="compoundSymmetricMatrix4"/> </precisionParameter> </multivariateNormalPrior>
<multivariateOUModel> element
Describes a multivariate OU process
The element has the following contents:
- SubstitutionModel element (exactly one)
- MatrixParameter element (exactly one)
- Element named
<data>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<times>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<design>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<independentVariables>containing:- MatrixParameter element (exactly one)
- MatrixParameter element (exactly one)
Example:
<multivariateOUModel> <substitutionEpochModel idref="substitutionEpochModel2"/> <diagonalMatrix idref="diagonalMatrix5"/> <data> <diagonalMatrix idref="diagonalMatrix5"/> </data> <times> <compoundParameter idref="compoundParameter6"/> </times> <design> <maskedParameter idref="maskedParameter4"/> </design> </multivariateOUModel>
<multivariateTDiffusionModel> element
Describes a multivariate t-distribution diffusion process.
The element has the following contents:
- Element named
<precisionParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<dfParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<multivariateTDiffusionModel> <precisionParameter> <designMatrix idref="designMatrix1"/> </precisionParameter> <dfParameter> <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/> </dfParameter> </multivariateTDiffusionModel>
<multivariateTraitLikelihood> element
Provides the likelihood of a continuous trait evolving on a tree by a given diffusion model.
The element takes following attributes:
- Attribute
traitNameis String- The name of the trait for which a likelihood should be calculated
- Attribute (optional)
integrateInternalTraitsis Boolean - Attribute (optional)
cutis Double; - Attribute (optional)
reportAsMultivariateis Boolean - Attribute (optional)
useTreeLengthis Boolean - Attribute (optional)
scaleByTimeis Boolean - Attribute (optional)
reciprocalRatesis Boolean - Attribute (optional)
randomSampleis Integer
The element has the following contents:
- Element named
<traitParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- MultivariateDistributionLikelihood element (zero or one)
- Element named
<conjugateRootPrior>containing: - MultivariateDiffusionModel element (exactly one)
- TreeModel element (exactly one)
- BranchRateModel element (zero or one)
- Parameter element (zero or one)
- Element named
<randomize>containing: - Element named
<jitter>containing: - Element named
<check>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" randomSample="1"> <traitParameter> <compoundParameter idref="compoundParameter6"/> </traitParameter> <greatCircleDiffusionModel idref="greatCircleDiffusionModel5"/> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/> </multivariateTraitLikelihood>
<multivariateWishartPrior> element
Calculates the likelihood of some data under a Wishart distribution.
The element takes following attributes:
The element has the following contents:
- Element named
<scaleMatrix>containing:- MatrixParameter element (exactly one)
- MatrixParameter element (exactly one)
- Element named
<data>containing:- MatrixParameter elements (one or more)
- MatrixParameter elements (one or more)
Example:
<multivariateWishartPrior nonInformative="true" df="1"> <data> <compoundSymmetricMatrix idref="compoundSymmetricMatrix5"/> <matrixParameter idref="matrixParameter5"/> </data> </multivariateWishartPrior>
<MutationDeathModel> element
This element represents an instance of the MutationDeath model of CTMC evolution with deletions.
The element has the following contents:
- AbstractSubstitutionModel element (zero or one)
- Parameter element (exactly one)
- MutationDeathType element (exactly one)
- Element named
<mutationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<MutationDeathModel> <designMatrix idref="designMatrix10"/> <extendedDataType idref="extendedDataType9"/> </MutationDeathModel>
<mvouOperator> element
This element returns junk.
The element takes following attributes:
- Attribute
mixingFactoris Double - Attribute
priorDfis Integer - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- MatrixParameter element (exactly one)
Example:
<mvouOperator mixingFactor="1.0" priorDf="1" weight="1.0" autoOptimize="true"> <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/> </mvouOperator>
<narrowExchange> element
This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- TreeModel element (exactly one)
Example:
<narrowExchange weight="1.0"> <treeModel idref="treeModel4"/> </narrowExchange>
<NearestNeighborInterchange> element
This element represents a NNI operator. This operator swaps a random subtree with its uncle.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- TreeModel element (exactly one)
Example:
<NearestNeighborInterchange weight="1.0"> <treeModel idref="treeModel9"/> </NearestNeighborInterchange>
<negativeStatistic> element
This element returns a statistic that is the element-wise negation of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<negativeStatistic> <argReassortmentNodeCount idref="argReassortmentNodeCount2"/> </negativeStatistic>
<negativeStatistic> element
This element returns a statistic that is the element-wise negation of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<negativeStatistic> <externalLengthStatistic idref="externalLengthStatistic3"/> </negativeStatistic>
<negativeStatistic> element
This element returns a statistic that is the element-wise negation of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<negativeStatistic> <argTotalLengthStatistic idref="argTotalLengthStatistic4"/> </negativeStatistic>
<neighborJoiningTree> element
This element returns a neighbour-joining tree generated from the given distances.
The element has the following contents:
- DistanceMatrix element (exactly one)
Example:
<neighborJoiningTree> <distanceMatrix idref="distanceMatrix5"/> </neighborJoiningTree>
<newARGEvent> element
An operator that slides a subarg.
The element takes following attributes:
- Attribute
weightis Integer - Attribute
sizeis Double - Attribute
gaussianis Boolean - Attribute (optional)
swapRatesis Boolean - Attribute (optional)
swapTraitsis Boolean - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- ARGModel element (exactly one)
Example:
<newARGEvent weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true"> <argTreeModel idref="argTreeModel9"/> </newARGEvent>
<newick> element
Constructs a tree from a NEWICK format tree description
The element takes following attributes:
- Attribute (optional)
usingDatesis Boolean - Attribute (optional)
rescaleHeightis Double- Attempt to rescale the tree to the given root height
- Attribute (optional)
rescaleLengthis Double- Attempt to rescale the tree to the given total length
- Attribute (optional)
unitsis String- The branch length units of this tree
The element has the following contents:
- String element (exactly one)
- The NEWICK format tree. Tip labels are taken to be Taxon IDs
Example:
<newick units="years"> ((A:1.0, B:1.0):1.0,(C:2.0, D:2.0):1.0); </newick>
<node> element
This element represents a node in a tree.
The element takes following attributes:
- Attribute (optional)
heightis Double- the age of the node
- Attribute (optional)
rateis Double- the relative rate of evolution at this node - default is 1.0
The element has the following contents:
- One of:
- Taxon element (exactly one)
- The taxon of this leaf node
- SimpleNode elements (exactly 2)
- The children of this internal node
- Taxon element (exactly one)
Example:
<node height="1.0" rate="1.0"> <node idref="node7"/> <node idref="node3"/> </node>
<nodeHeightsStatistic> element
A statistic that returns the heights of each internal node in increasing order (or groups them by a group size parameter)
The element takes following attributes:
- Attribute (optional)
nameis String
The element has the following contents:
Example:
<nodeHeightsStatistic name="foo"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1"/> </nodeHeightsStatistic>
<nodePosteriorLikelihood> element
This element represents the likelihood of a patternlist on a tree given the site model.
The element takes following attributes:
The element has the following contents:
- PatternList element (exactly one)
- TreeModel element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (zero or one)
- SubstitutionModel element (exactly one)
Example:
<nodePosteriorLikelihood useAmbiguities="true" allowMissingTaxa="true"> <convert idref="convert4"/> <treeModel idref="treeModel3"/> <siteModel idref="siteModel7"/> <covarionModel idref="covarionModel10"/> </nodePosteriorLikelihood>
<nodeReHeight> element
Specialized Species tree operator, transform tree without breaking embedding of gene trees.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- SpeciesBindings element (exactly one)
- SpeciesTreeModel element (exactly one)
Example:
<nodeReHeight weight="1.0"> <species idref="species1"/> <speciesTree idref="speciesTree3"/> </nodeReHeight>
<normalDistributionModel> element
Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element
The element has the following contents:
- Element named
<mean>containing:
- One of:
Example:
<normalDistributionModel> <mean> <compoundSymmetricMatrix idref="compoundSymmetricMatrix10"/> </mean> <stdev> 1.0 </stdev> </normalDistributionModel>
<normalGammaPrecisionGibbsOperator> element
This element returns a operator on the precision parameter of a normal model with gamma prior.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Element named
<likelihood>containing:- DistributionLikelihood element (exactly one)
- DistributionLikelihood element (exactly one)
- Element named
<prior>containing:- DistributionLikelihood element (exactly one)
- DistributionLikelihood element (exactly one)
Example:
<normalGammaPrecisionGibbsOperator weight="1.0"> <likelihood> <cachedPrior idref="cachedPrior3"/> </likelihood> <prior> <distributionLikelihood idref="distributionLikelihood8"/> </prior> </normalGammaPrecisionGibbsOperator>
<normalNormalMeanGibbsOperator> element
This element returns a operator on the mean parameter of a normal model with normal prior.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Element named
<likelihood>containing:- DistributionLikelihood element (exactly one)
- DistributionLikelihood element (exactly one)
- Element named
<prior>containing:- DistributionLikelihood element (exactly one)
- DistributionLikelihood element (exactly one)
Example:
<normalNormalMeanGibbsOperator weight="1.0"> <likelihood> <twoPartDistribution idref="twoPartDistribution10"/> </likelihood> <prior> <twoPartDistribution idref="twoPartDistribution6"/> </prior> </normalNormalMeanGibbsOperator>
<normalPrior> element
Calculates the prior probability of some data under a given normal distribution.
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<normalPrior mean="1.0" stdev="1.0"> <logarithmStatistic idref="logarithmStatistic8"/> <rateCovarianceStatistic idref="rateCovarianceStatistic8"/> <monotonicStatistic idref="monotonicStatistic6"/> <argTotalLengthStatistic idref="argTotalLengthStatistic1"/> </normalPrior>
<notStatistic> element
This element returns a statistic that is the element-wise inverse of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<notStatistic> <argReassortmentNodeCount idref="argReassortmentNodeCount5"/> </notStatistic>
<notStatistic> element
This element returns a statistic that is the element-wise inverse of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<notStatistic> <argReassortmentNodeCount idref="argReassortmentNodeCount9"/> </notStatistic>
<oneOnXPrior> element
Calculates the (improper) prior proportional to Prod_i (1/x_i) for the given statistic x.
The element has the following contents:
- One of:
Example:
<oneOnXPrior> <argTreeCount idref="argTreeCount6"/> <treeShapeStatistics idref="treeShapeStatistics5"/> </oneOnXPrior>
<onePGammaDistributionModel> element
A model of a one parameter gamma distribution.
The element has the following contents:
- One of:
Example:
<onePGammaDistributionModel> <shape> <designMatrix idref="designMatrix5"/> </shape> </onePGammaDistributionModel>
<operators> element
A simple operator scheduler
The element takes following attributes:
The element has the following contents:
- MCMCOperator elements (one or more)
Example:
<operators sequential="true" optimizationSchedule="foo"> <argSwapOperator idref="argSwapOperator8"/> </operators>
<optimizer> element
This element returns a maximum likelihood heuristic optimizer and runs the optimization as a side effect.
The element takes following attributes:
- Attribute
chainLengthis Integer
The element has the following contents:
- OperatorSchedule element (exactly one)
- Likelihood element (exactly one)
- Logger elements (one or more)
Example:
<optimizer chainLength="1"> <operators idref="operators7"/> <speciesCoalescent idref="speciesCoalescent4"/> <logArgTree idref="logArgTree6"/> <logArg idref="logArg2"/> <logML idref="logML6"/> </optimizer>
<Ornstein-Uhlenbeck> element
The element takes following attributes:
The element has the following contents:
- One of:
- One of:
- One of:
- VariableDemographicModel element (zero or one)
- Element named
<data>containing:- Statistic element (exactly one)
- Statistic element (exactly one)
- Element named
<times>containing:- Statistic element (exactly one)
- Statistic element (exactly one)
Example:
<Ornstein-Uhlenbeck logUnits="true" normalize="true"> <mean> <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/> </mean> <sigma> 1.0 </sigma> <lambda> 1.0 </lambda> </Ornstein-Uhlenbeck>
<ovariableSkyLineLikelihood> element
This element represents the likelihood of the tree given the population size vector.
The element takes following attributes:
The element has the following contents:
- Element named
<populationSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<indicators>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<populationTree>containing:- TreeModel element (exactly one)
- TreeModel element (exactly one)
Example:
<ovariableSkyLineLikelihood type="true" logUnits="true"> <populationSizes> <maskedParameter idref="maskedParameter1"/> </populationSizes> <indicators> <designMatrix idref="designMatrix4"/> </indicators> <populationTree> <treeModel idref="treeModel10"/> </populationTree> </ovariableSkyLineLikelihood>
<parameter> element
A real-valued parameter of one or more dimensions.
The element takes following attributes:
- Attribute (optional)
valueis Double; - Attribute (optional)
dimensionis Integer - Attribute (optional)
upperis Double; - Attribute (optional)
loweris Double;
The element has the following contents:
- Element named
<randomize>containing:- Distribution element (exactly one)
- Distribution element (exactly one)
Example:
<parameter value="0.5 1.0" dimension="1" upper="0.5 1.0" lower="0.5 1.0"/>
<parsimonyStateStatistic> element
A statistic that has as its value the parsimony state reconstruction of a binary state defined by a set of taxa at a given MRCA of a tree
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic for the purposes of logging
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<state>containing:- Taxa element (exactly one)
- Taxa element (exactly one)
- Element named
<mrca>containing:- Taxa element (exactly one)
- Taxa element (exactly one)
Example:
<parsimonyStateStatistic name="foo"> <treeModel idref="treeModel6"/> <state> <taxa idref="taxa5"/> </state> <mrca> <taxa idref="taxa8"/> </mrca> </parsimonyStateStatistic>
<parsimonyStatistic> element
A statistic that has as its value the parsimony tree length of a set of a binary state defined by a set of taxa for a given tree
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
The element has the following contents:
Example:
<parsimonyStatistic name="foo"> <treeModel idref="treeModel8"/> <state> <taxa idref="taxa2"/> </state> </parsimonyStatistic>
<partitionStatistic> element
null
Example:
<partitionStatistic/>
<patterns> element
A weighted list of the unique site patterns (unique columns) in an alignment.
The element takes following attributes:
- Attribute (optional)
fromis Integer- The site position to start at, default is 1 (the first position)
- Attribute (optional)
tois Integer- The site position to finish at, must be greater than from, default is length of given alignment
- Attribute (optional)
everyis Integer- Determines how many sites are selected. A value of 3 will select every third site starting from from, default is 1 (every site)
- Attribute (optional)
stripis Boolean- Strip out completely ambiguous sites
- Attribute (optional)
uniqueis Boolean- Return a weight list of unique patterns
The element has the following contents:
- Element named
<taxonList>containing:- TaxonList element (exactly one)
- TaxonList element (exactly one)
- Alignment element (exactly one)
Example:
<patterns from="1" to="1" every="1" strip="true" unique="true"> <hypermutantAlignment idref="hypermutantAlignment7"/> </patterns>
<patternSubSet> element
A weighted list of the unique site patterns (unique columns) in an alignment.
The element takes following attributes:
- Attribute (optional)
subSetis Integer- Which subset of patterns to use (out of subSetCount)
- Attribute (optional)
subSetCountis Integer- The number of subsets
The element has the following contents:
- SiteList element (exactly one)
Example:
<patternSubSet subSet="1" subSetCount="1"> <alignment idref="alignment10"/> </patternSubSet>
<piecewisePopulation> element
This element represents a piecewise population model
The element takes following attributes:
- Attribute (optional)
linearis Boolean
The element has the following contents:
- One of:
- Element named
<epochWidths>containing:- Attribute
widthsis Double;
- Attribute
Example:
<piecewisePopulation linear="true"> <epochSizes> <parameter idref="parameter2"/> </epochSizes> <epochWidths widths="0.5 1.0"/> </piecewisePopulation>
<poissonPartitionLikelihood> element
null
The element takes following attributes:
- Attribute
meanis Double
The element has the following contents:
- ARGModel element (exactly one)
Example:
<poissonPartitionLikelihood mean="1.0"> <argTreeModel idref="argTreeModel6"/> </poissonPartitionLikelihood>
<poissonPrior> element
Calculates the prior probability of some data under a given poisson distribution.
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<poissonPrior mean="1.0" offset="1.0"> <generalizedSkylinePopSizeStatistic idref="generalizedSkylinePopSizeStatistic8"/> <loggableStatistic idref="loggableStatistic4"/> </poissonPrior>
<polygon> element
This element represents a polygon.
The element takes following attributes:
The element has the following contents:
- One of:
- KMLCoordinates element (exactly one)
- Polygon2D element (exactly one)
- KMLCoordinates element (exactly one)
Example:
<polygon closed="true" fillValue="1.0"> <polygon idref="polygon1"/> </polygon>
<poolSwapOperator> element
.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- ValuesPool element (exactly one)
Example:
<poolSwapOperator weight="1.0"> ERROR! </poolSwapOperator>
<popGraph> element
This element returns a statistic that is the population size at evenly spaced intervals over tree.
The element takes following attributes:
- Attribute
timeis Double
The element has the following contents:
- VariableDemographicModel element (exactly one)
Example:
<popGraph time="1.0"> <variableDemographic idref="variableDemographic9"/> </popGraph>
<positiveDefiniteSubstitutionModel> element
A general reversible model of sequence substitution for any data type with stochastic variable selection.
The element has the following contents:
- MatrixParameter element (exactly one)
Example:
<positiveDefiniteSubstitutionModel> <designMatrix idref="designMatrix7"/> </positiveDefiniteSubstitutionModel>
<compoundLikelihood> element
A likelihood function which is simply the product of its component likelihood functions.
The element takes following attributes:
- Attribute (optional)
threadsis Integer
The element has the following contents:
- Likelihood elements (one or more)
Example:
<compoundLikelihood threads="1"> <booleanLikelihood idref="booleanLikelihood5"/> <ancestralTreeLikelihood idref="ancestralTreeLikelihood2"/> </compoundLikelihood>
<precisionGibbsOperator> element
This element returns a multivariate normal random walk operator on a given parameter.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- AbstractMultivariateTraitLikelihood element (exactly one)
- MultivariateDistributionLikelihood element (exactly one)
Example:
<precisionGibbsOperator weight="1.0"> <multivariateTraitLikelihood idref="multivariateTraitLikelihood4"/> <multivariateNormalPrior idref="multivariateNormalPrior10"/> </precisionGibbsOperator>
<compoundLikelihood> element
A likelihood function which is simply the product of its component likelihood functions.
The element takes following attributes:
- Attribute (optional)
threadsis Integer
The element has the following contents:
- Likelihood elements (one or more)
Example:
<compoundLikelihood threads="1"> <ancestralTreeLikelihood idref="ancestralTreeLikelihood1"/> <UCLikelihood idref="UCLikelihood6"/> <UCLikelihood idref="UCLikelihood4"/> </compoundLikelihood>
<productStatistic> element
This element returns a statistic that is the product of the child statistics.
The element takes following attributes:
- Attribute (optional)
elementwiseis Boolean
The element has the following contents:
- Statistic elements (one or more)
Example:
<productStatistic elementwise="true"> <rateStatistic idref="rateStatistic4"/> </productStatistic>
<productStatistic> element
This element returns a statistic that is the product of the child statistics.
The element takes following attributes:
- Attribute (optional)
elementwiseis Boolean
The element has the following contents:
- Statistic elements (one or more)
Example:
<productStatistic elementwise="true"> <differenceStatistic idref="differenceStatistic5"/> <reciprocalStatistic idref="reciprocalStatistic6"/> <matrixParameter idref="matrixParameter8"/> </productStatistic>
<property> element
This element returns an object representing the named property of the given child object.
The element takes following attributes:
- Attribute
nameis String- name of the property
The element has the following contents:
- Object element (exactly one)
Example:
<property name="length"> <uniformPartitionLikelihood idref="uniformPartitionLikelihood1"/> </property>
<randomDiscretizedBranchRates> element
This element returns a random discretized relaxed clock model.The branch rates are drawn from a continuous parametric distribution.
The element takes following attributes:
- Attribute (optional)
singleRootRateis Boolean- Whether only a single rate should be used for the two children branches of the root
- Attribute (optional)
normalizeis Boolean- Whether the mean rate has to be normalized to a particular value
- Attribute (optional)
normalizeBranchRateTois Double- The mean rate to normalize to, if normalizing
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<distribution>containing:- ParametricDistributionModel element (exactly one)
- The distribution model for rates among branches
- ParametricDistributionModel element (exactly one)
- Element named
<rateCategoryQuantiles>containing:- Parameter element (exactly one)
- The quantiles for
- Parameter element (exactly one)
Example:
<randomDiscretizedBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0"> <treeModel idref="treeModel9"/> <distribution> <inverseGaussianDistributionModel idref="inverseGaussianDistributionModel2"/> </distribution> <rateCategoryQuantiles> <parameter idref="parameter2"/> </rateCategoryQuantiles> </randomDiscretizedBranchRates>
<randomLocalClockModel> element
This element returns an random local clock (RLC) model.Each branch either has a new rate or inherits the rate of the branch above it depending on the indicator vector, which is itself sampled.
The element takes following attributes:
- Attribute
ratesAreMultipliersis Boolean
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<rateIndicator>containing:- Parameter element (exactly one)
- The rate change indicators parameter
- Parameter element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- The rates parameter
- Parameter element (exactly one)
- Element named
<clockRate>containing:- Parameter element (exactly one)
- The mean rate across all local clocks
- Parameter element (exactly one)
Example:
<randomLocalClockModel ratesAreMultipliers="true"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3"/> <rateIndicator> <designMatrix idref="designMatrix7"/> </rateIndicator> <rates> <duplicatedParameter idref="duplicatedParameter9"/> </rates> </randomLocalClockModel>
<randomLocalLogger> element
A speciation model of a Yule process whose rate can evolve down the tree.
The element takes following attributes:
The element has the following contents:
- TreeModel element (exactly one)
- RandomLocalTreeVariable element (exactly one)
Example:
<randomLocalLogger logEvery="1" fileName="foo"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3"/> <randomLocalClockModel idref="randomLocalClockModel1"/> </randomLocalLogger>
<randomLocalYuleModel> element
A speciation model of a Yule process whose rate can change at random nodes in the tree.
The element takes following attributes:
- Attribute
ratesAsMultipliersis Boolean - Attribute (optional)
dpis Integer - Attribute
unitsis String- the units
The element has the following contents:
- Element named
<birthRates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<indicators>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<meanRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<randomLocalYuleModel ratesAsMultipliers="true" dp="1" units="days"> <birthRates> <maskedParameter idref="maskedParameter1"/> </birthRates> <indicators> <maskedParameter idref="maskedParameter9"/> </indicators> <meanRate> <matrixParameter idref="matrixParameter10"/> </meanRate> </randomLocalYuleModel>
<randomTaxaSample> element
Randomly samples n taxa from a collection of N taxa
The element takes following attributes:
- Attribute
sampleis Integer
The element has the following contents:
- Taxa element (exactly one)
Example:
<randomTaxaSample sample="1"> <taxa idref="taxa5"/> </randomTaxaSample>
<randomWalk> element
Describes a first-order random walk. No prior is assumed on the first data element
The element takes following attributes:
- Attribute (optional)
logScaleis Boolean
The element has the following contents:
- Parameter element (exactly one)
- One of:
- ParametricDistributionModel element (exactly one)
- DistributionLikelihood element (exactly one)
- ParametricDistributionModel element (exactly one)
Example:
<randomWalk logScale="true"> <maskedParameter idref="maskedParameter6"/> <normalDistributionModel idref="normalDistributionModel7"/> </randomWalk>
<randomWalkIntegerNodeHeightWeightedOperator> element
This element returns a random walk node height weighted operator on a given parameter.
The element takes following attributes:
The element has the following contents:
- Parameter element (exactly one)
- Element named
<internalNodeHeights>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<randomWalkIntegerNodeHeightWeightedOperator windowSize="1.0" weight="1.0"> <parameter idref="parameter2"/> <internalNodeHeights> <duplicatedParameter idref="duplicatedParameter2"/> </internalNodeHeights> </randomWalkIntegerNodeHeightWeightedOperator>
<randomWalkIntegerOperator> element
This element returns a random walk operator on a given parameter.
The element takes following attributes:
The element has the following contents:
- Parameter element (exactly one)
Example:
<randomWalkIntegerOperator windowSize="1.0" weight="1.0"> <parameter idref="parameter10"/> </randomWalkIntegerOperator>
<randomWalkIntegerSetSizeWeightedOperator> element
This element returns a random walk set size weighted operator on a given parameter.
The element takes following attributes:
The element has the following contents:
- Parameter element (exactly one)
- MicrosatelliteSamplerTreeModel element (exactly one)
Example:
<randomWalkIntegerSetSizeWeightedOperator windowSize="1.0" weight="1.0" baseSetSize="1.0"> <maskedParameter idref="maskedParameter7"/> <microsatelliteSamplerTreeModel idref="microsatelliteSamplerTreeModel5"/> </randomWalkIntegerSetSizeWeightedOperator>
<randomWalkOnMapOperator> element
This element returns a random walk operator on a given map.
The element takes following attributes:
- Attribute
windowSizeis Double - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- MapDiffusionModel element (exactly one)
- Parameter element (exactly one)
Example:
<randomWalkOnMapOperator windowSize="1.0" weight="1.0" autoOptimize="true"> ERROR! <compoundParameter idref="compoundParameter2"/> </randomWalkOnMapOperator>
<randomWalkOperator> element
This element returns a random walk operator on a given parameter.
The element takes following attributes:
- Attribute
windowSizeis Double - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean - Attribute (optional)
boundaryConditionis String
The element has the following contents:
- Parameter element (exactly one)
Example:
<randomWalkOperator windowSize="1.0" weight="1.0" autoOptimize="true" boundaryCondition="reflecting"> <diagonalMatrix idref="diagonalMatrix7"/> </randomWalkOperator>
<rateBitExchangeOperator> element
This element returns a bit-flip operator on a given parameter.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Element named
<bits>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<rateBitExchangeOperator weight="1.0"> <bits> <diagonalMatrix idref="diagonalMatrix10"/> </bits> <rates> <matrixParameter idref="matrixParameter3"/> </rates> </rateBitExchangeOperator>
<rateCovarianceStatistic> element
A statistic that has as its value the covariance of parent and child branch rates
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
The element has the following contents:
- TreeModel element (exactly one)
- BranchRateModel element (exactly one)
Example:
<rateCovarianceStatistic name="foo"> <treeModel idref="treeModel5"/> <rateEpochBranchRates idref="rateEpochBranchRates7"/> </rateCovarianceStatistic>
<rateEpochBranchRates> element
This element provides a multiple epoch molecular clock model. All branches (or portions of them) have the same rate of molecular evolution within a given epoch. If parameters are used to sample transition times, these must be kept in ascending order by judicious use of bounds or priors.
The element takes following attributes:
- Attribute (optional)
continuousNormalizationis Boolean- Special rate normalization for a Brownian diffusion process
The element has the following contents:
- Element named
<epoch>containing:- Attribute (optional)
transitionTimeis Double- The time of transition between this epoch and the previous one
- Parameter element (exactly one)
- The evolutionary rate parameter for this epoch
- Element named
<transitionTime>containing:- Parameter element (exactly one)
- The transition time parameter for this epoch
- An epoch that lasts until transitionTime
- Parameter element (exactly one)
- Attribute (optional)
- Element named
<rate>containing:- Parameter element (exactly one)
- The ancestral molecular evolutionary rate parameter
- Parameter element (exactly one)
- Element named
<rootHeight>containing:- Parameter element (exactly one)
- The tree root height
- Parameterization may require the root height
- Parameter element (exactly one)
Example:
<rateEpochBranchRates continuousNormalization="true"> <epoch transitionTime="1.0"> <compoundSymmetricMatrix idref="compoundSymmetricMatrix5"/> </epoch> <rate> <duplicatedParameter idref="duplicatedParameter1"/> </rate> </rateEpochBranchRates>
<rateExchange> element
An operator that exchanges rates and traits on a tree.
The element takes following attributes:
- Attribute
weightis Double - Attribute
swapRatesis Boolean - Attribute
swapTraitsis Boolean - Attribute
swapAtRootis Boolean - Attribute
moveHeightis Boolean
The element has the following contents:
- TreeModel element (exactly one)
Example:
<rateExchange weight="1.0" swapRates="true" swapTraits="true" swapAtRoot="true" moveHeight="true"> <treeModel idref="treeModel6"/> </rateExchange>
<rateSampleOperator> element
This element returns a rateSample operator on a given parameter.
The element takes following attributes:
The element has the following contents:
- TreeModel element (exactly one)
- RateEvolutionLikelihood element (zero or one)
Example:
<rateSampleOperator weight="1.0" sampleAll="true"> <treeModel idref="treeModel2"/> </rateSampleOperator>
<rateScaleOperator> element
This element returns a rateScale operator on a given parameter.
The element takes following attributes:
- Attribute
scaleFactoris Double - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean - Attribute (optional)
noRootis Boolean
The element has the following contents:
- TreeModel element (exactly one)
Example:
<rateScaleOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" noRoot="true"> <treeModel idref="treeModel7"/> </rateScaleOperator>
<rateStatistic> element
A statistic that returns the average of the branch rates
The element takes following attributes:
- Attribute
internalis Boolean - Attribute
externalis Boolean - Attribute
modeis String- This attribute determines how the rates are summarized, can be one of (mean, variance, coefficientOfVariance)
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
The element has the following contents:
- TreeModel element (exactly one)
- BranchRateModel element (exactly one)
Example:
<rateStatistic internal="true" external="true" mode="coefficientOfVariation" name="foo"> <treeModel idref="treeModel8"/> <strictClockBranchRates idref="strictClockBranchRates1"/> </rateStatistic>
<rateVarianceScaleOperator> element
This element returns a rateScale operator on a given parameter.
The element takes following attributes:
- Attribute
scaleFactoris Double - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
Example:
<rateVarianceScaleOperator scaleFactor="1.0" weight="1.0" autoOptimize="true"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2"/> <duplicatedParameter idref="duplicatedParameter1"/> </rateVarianceScaleOperator>
<ratioStatistic> element
This element returns a statistic that is the ratio of the 2 child statistics.
The element has the following contents:
- Statistic elements (exactly 2)
- The two operand statistics
Example:
<ratioStatistic> <argTimingStatistic idref="argTimingStatistic3"/> <generalizedSkylinePopSizeStatistic idref="generalizedSkylinePopSizeStatistic4"/> </ratioStatistic>
<ratioStatistic> element
This element returns a statistic that is the ratio of the 2 child statistics.
The element has the following contents:
- Statistic elements (exactly 2)
- The two operand statistics
Example:
<ratioStatistic> <externalLengthStatistic idref="externalLengthStatistic7"/> <varianceStatistic idref="varianceStatistic4"/> </ratioStatistic>
<reciprocalStatistic> element
This element returns a statistic that is the element-wise reciprocal of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<reciprocalStatistic> <statistic idref="statistic8"/> </reciprocalStatistic>
<reciprocalStatistic> element
This element returns a statistic that is the element-wise reciprocal of the child statistic.
The element has the following contents:
- Statistic element (exactly one)
Example:
<reciprocalStatistic> <negativeStatistic idref="negativeStatistic7"/> </reciprocalStatistic>
<regressionGibbsEffectOperator> element
This element returns a multivariate Gibbs operator on an internal node trait.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Parameter element (exactly one)
- MultivariateDistributionLikelihood element (exactly one)
- LinearRegression element (exactly one)
- Element named
<indicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<regressionGibbsEffectOperator weight="1.0"> <maskedParameter idref="maskedParameter5"/> <multivariateGammaPrior idref="multivariateGammaPrior3"/> ERROR! </regressionGibbsEffectOperator>
<regressionGibbsPrecisionOperator> element
This element returns a multivariate Gibbs operator on an internal node trait.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Parameter element (exactly one)
- DistributionLikelihood element (exactly one)
- LinearRegression element (exactly one)
Example:
<regressionGibbsPrecisionOperator weight="1.0"> <compoundParameter idref="compoundParameter6"/> <cachedPrior idref="cachedPrior5"/> ERROR! </regressionGibbsPrecisionOperator>
<regressionMetropolizedIndicatorOperator> element
This element returns a multivariate Gibbs operator on an internal node trait.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Parameter element (exactly one)
- MultivariateDistributionLikelihood element (exactly one)
- LinearRegression element (exactly one)
- Element named
<indicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<mask>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<regressionMetropolizedIndicatorOperator weight="1.0"> <compoundParameter idref="compoundParameter7"/> <multivariateNormalPrior idref="multivariateNormalPrior3"/> ERROR! <indicator> <duplicatedParameter idref="duplicatedParameter10"/> </indicator> </regressionMetropolizedIndicatorOperator>
<report> element
Generates a report using the given text and elements
The element takes following attributes:
- Attribute (optional)
typeis String- The format of the report
- Attribute (optional)
titleis String- The title of the report
- Attribute (optional)
fileNameis String
The element has the following contents:
- Object elements (one or more)
- An arbitrary mixture of text and elements to report
Example:
<report type="XHTML" title="Report" fileName="foo"> <randomWalkOnMapOperator idref="randomWalkOnMapOperator1"/> <argUniformPrior idref="argUniformPrior2"/> <NearestNeighborInterchange idref="NearestNeighborInterchange2"/> </report>
<RPNcalculator> element
This element returns a statistic evaluated from arbitrary expression.
The element has the following contents:
- Element named
<expression>containing:- String element (exactly one)
- String element (exactly one)
- Element named
<variable>containing:- Statistic element (exactly one)
- Statistic element (exactly one)
Example:
<RPNcalculator> <expression> foo </expression> <variable> <parsimonyStatistic idref="parsimonyStatistic6"/> </variable> <variable> <logarithmStatistic idref="logarithmStatistic10"/> </variable> <variable> <RPNcalculator idref="RPNcalculator2"/> </variable> </RPNcalculator>
<sampleNonActiveOperator> element
This element returns a Gibbs operator for the joint distribution of population sizes.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Element named
<distribution>containing:- ParametricDistributionModel element (exactly one)
- ParametricDistributionModel element (exactly one)
- Element named
<indicators>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<data>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<sampleNonActiveOperator weight="1.0"> <distribution> <logNormalDistributionModel idref="logNormalDistributionModel8"/> </distribution> <indicators> <duplicatedParameter idref="duplicatedParameter6"/> </indicators> <data> <matrixParameter idref="matrixParameter3"/> </data> </sampleNonActiveOperator>
<sampleStateAndCategoryModel> element
A SiteModel that has a discrete distribution of substitution models over sites, designed for sampling of rate categories and internal states.
The element has the following contents:
- Element named
<mutationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<categoriesParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- SubstitutionModel elements (one or more)
Example:
<sampleStateAndCategoryModel> <mutationRate> <parameter idref="parameter7"/> </mutationRate> <categoriesParameter> <maskedParameter idref="maskedParameter2"/> </categoriesParameter> <gtrModel idref="gtrModel4"/> <CovarionHKYModel idref="CovarionHKYModel3"/> <aminoAcidModel idref="aminoAcidModel2"/> </sampleStateAndCategoryModel>
<sampleStateModel> element
A SiteModel that has a discrete distribution of substitution models over sites, designed for sampling of internal states.
The element has the following contents:
- Element named
<mutationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<proportions>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- SubstitutionModel elements (one or more)
Example:
<sampleStateModel> <mutationRate> <matrixParameter idref="matrixParameter5"/> </mutationRate> <proportions> <matrixParameter idref="matrixParameter5"/> </proportions> <positiveDefiniteSubstitutionModel idref="positiveDefiniteSubstitutionModel8"/> <MutationDeathModel idref="MutationDeathModel4"/> <yangCodonModel idref="yangCodonModel3"/> </sampleStateModel>
<scaledPiecewisePopulation> element
This element represents a piecewise population model
The element takes following attributes:
The element has the following contents:
- Element named
<populationSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<populationTree>containing:- TreeModel element (exactly one)
- TreeModel element (exactly one)
Example:
<scaledPiecewisePopulation units="years" linear="true"> <populationSizes> <diagonalMatrix idref="diagonalMatrix8"/> </populationSizes> <populationTree> <treeModel idref="treeModel10"/> </populationTree> </scaledPiecewisePopulation>
<scaledTreeLengthModel> element
This element returns a branch rate model that scales the total length of the tree to specified valued (default=1.0).
The element has the following contents:
- Element named
<scalingFactor>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- TreeModel element (exactly one)
Example:
<scaledTreeLengthModel> <treeModel idref="treeModel7"/> </scaledTreeLengthModel>
<scaleOperator> element
This element returns a scale operator on a given parameter.
The element takes following attributes:
- Attribute
scaleFactoris Double - Attribute (optional)
scaleAllis Boolean - Attribute (optional)
scaleAllIndependentlyis Boolean - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean - Attribute (optional)
dfis Integer
The element has the following contents:
- Parameter element (exactly one)
- Element named
<indicators>containing:
Example:
<scaleOperator scaleFactor="1.0" scaleAll="true" scaleAllIndependently="true" weight="1.0" autoOptimize="true" df="1"> <compoundParameter idref="compoundParameter4"/> </scaleOperator>
<selectorOperator> element
.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- Parameter element (exactly one)
Example:
<selectorOperator weight="1.0"> <matrixParameter idref="matrixParameter8"/> </selectorOperator>
<sequence> element
A biomolecular sequence.
The element has the following contents:
- Taxon element (exactly one)
- String element (exactly one)
- A character string representing the aligned molecular sequence
Example:
<sequence> <taxon idref="taxon3"/> ACGACTAGCATCGAGCTTCG--GATAGCATGC </sequence>
<sequenceErrorModel> element
This element returns a model that allows for post-mortem DNA damage.
The element takes following attributes:
- Attribute (optional)
typeis String
The element has the following contents:
- Element named
<baseErrorRate>containing:- Parameter element (exactly one)
- The base error rate per site per sequence
- Parameter element (exactly one)
- Element named
<ageRelatedErrorRate>containing:- Parameter element (exactly one)
- The error rate per site per unit time
- Parameter element (exactly one)
- Element named
<indicators>containing:- Parameter element (exactly one)
- A binary indicator of whether the sequence has errors
- Parameter element (exactly one)
- One of:
Example:
<sequenceErrorModel type="foo"> <include> <patternSubSet idref="patternSubSet2"/> </include> </sequenceErrorModel>
<sequenceSimulator> element
A SequenceSimulator that generates random sequences for a given tree, sitemodel and branch rate model
The element takes following attributes:
- Attribute
replicationsis Integer
The element has the following contents:
- Tree element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (zero or one)
Example:
<sequenceSimulator replications="1"> <newick idref="newick10"/> <sampleStateModel idref="sampleStateModel3"/> </sequenceSimulator>
<setOperator> element
This element represents an operator on a set.
The element takes following attributes:
The element has the following contents:
- Parameter element (exactly one)
Example:
<setOperator set="0.5 1.0" weight="1.0"> <compoundParameter idref="compoundParameter8"/> </setOperator>
<singleTipObservationProcess> element
This element represents an instance of the SingleTipObservationProcess for ALSTreeLikelihood calculations
The element has the following contents:
- TreeModel element (exactly one)
- PatternList element (exactly one)
- Taxon element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (exactly one)
- Element named
<deathRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<immigrationRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<singleTipObservationProcess> <treeModel idref="treeModel3"/> <convert idref="convert10"/> <taxon idref="taxon2"/> <categorySiteModel idref="categorySiteModel6"/> <continuousTraitRateModel idref="continuousTraitRateModel5"/> <deathRate> <diagonalMatrix idref="diagonalMatrix1"/> </deathRate> <immigrationRate> <parameter idref="parameter4"/> </immigrationRate> </singleTipObservationProcess>
<siteModel> element
A SiteModel that has a gamma distributed rates across sites
The element has the following contents:
- Element named
<substitutionModel>containing:- SubstitutionModel element (exactly one)
- SubstitutionModel element (exactly one)
- One of:
- Element named
<gammaShape>containing: - Element named
<proportionInvariant>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<siteModel> <substitutionModel> <binarySubstitutionModel idref="binarySubstitutionModel2"/> </substitutionModel> <relativeRate> <designMatrix idref="designMatrix6"/> </relativeRate> </siteModel>
<gmrfSkyrideLikelihood> element
This element represents the likelihood of the tree given the population size vector.
The element takes following attributes:
- Attribute (optional)
rescaleByRootHeightis Boolean - Attribute (optional)
randomizeTreeis Boolean - Attribute (optional)
timeAwareSmoothingis Boolean
The element has the following contents:
- Element named
<populationSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<precisionParameter>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<populationTree>containing:- TreeModel elements (one or more)
- TreeModel elements (one or more)
- Element named
<groupSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true"> <populationSizes> <parameter idref="parameter3"/> </populationSizes> <precisionParameter> <duplicatedParameter idref="duplicatedParameter6"/> </precisionParameter> <populationTree> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel9"/> <treeModel idref="treeModel10"/> </populationTree> </gmrfSkyrideLikelihood>
<slidingPatternsOperator> element
This element returns a sliding window operator on alignment sites.
The element takes following attributes:
- Attribute
windowSizeis Integer - Attribute
weightis Integer - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- Element named
<breakPoints>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- SitePatterns elements ( to 100)
Example:
<slidingPatternsOperator windowSize="1" weight="1" autoOptimize="true"> <breakPoints> <diagonalMatrix idref="diagonalMatrix5"/> </breakPoints> ERROR! ERROR! </slidingPatternsOperator>
<sp> element
Taxon in a species tree
The element has the following contents:
- Taxon elements (one or more)
Example:
<sp> <taxon idref="taxon10"/> <sp idref="sp8"/> <taxon idref="taxon4"/> <taxon idref="taxon2"/> </sp>
<speciationLikelihood> element
This element represents the likelihood of the tree given the speciation.
The element has the following contents:
- Element named
<model>containing:- SpeciationModel element (exactly one)
- SpeciationModel element (exactly one)
- Element named
<speciesTree>containing:- Tree element (exactly one)
- Tree element (exactly one)
- Element named
<include>containing:- Taxa elements (one or more)
- One or more subsets of taxa which should be included from calculate the likelihood (the remaining taxa are excluded)
- Taxa elements (one or more)
- Element named
<exclude>containing:- Taxa elements (one or more)
- One or more subsets of taxa which should be excluded from calculate the likelihood (which is calculated on the remaining subtree)
- Taxa elements (one or more)
Example:
<speciationLikelihood> <model> <yuleModel idref="yuleModel4"/> </model> <speciesTree> <neighborJoiningTree idref="neighborJoiningTree3"/> </speciesTree> </speciationLikelihood>
<species> element
Binds taxa in gene trees with species information.
The element has the following contents:
- SpeciesBindings$SPinfo elements ( or more)
- Element named
<geneTrees>containing:
Example:
<species>
<sp idref="sp7"/>
<sp idref="sp1"/>
<sp idref="sp4"/>
<sp idref="sp1"/>
<geneTrees>
<empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/>
<treeModel idref="treeModel3"/>
<treeModel idref="treeModel10"/>
<empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8"/>
<gtree ploidy="1.0">
<treeModel idref="treeModel6"/>
</gtree>
<gtree ploidy="1.0">
<treeModel idref="treeModel7"/>
</gtree>
<gtree ploidy="1.0">
<empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1"/>
</gtree>
<gtree ploidy="1.0">
<treeModel idref="treeModel6"/>
</gtree>
</geneTrees>
</species>
<speciesCoalescent> element
Compute coalecent log-liklihood of a set of gene trees embedded inside one species tree.
The element has the following contents:
- SpeciesBindings element (exactly one)
- SpeciesTreeModel element (exactly one)
Example:
<speciesCoalescent> <species idref="species2"/> <speciesTree idref="speciesTree8"/> </speciesCoalescent>
<speciesTree> element
Species tree which includes demographic function per branch.
The element takes following attributes:
- Attribute (optional)
bmPrioris Boolean - Attribute (optional)
constantRootis Boolean - Attribute (optional)
constantPopulationis Boolean
The element has the following contents:
- SpeciesBindings element (exactly one)
- Tree element (zero or one)
- Element named
<sppSplitPopulations>containing: - Element named
<coalescentPointsPopulations>containing: - Element named
<coalescentPointsIndicators>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<speciesTree bmPrior="true" constantRoot="true" constantPopulation="true"> <species idref="species1"/> <sppSplitPopulations value="1.0"> <diagonalMatrix idref="diagonalMatrix10"/> </sppSplitPopulations> </speciesTree>
<speciesTreePopulationPrior> element
The element has the following contents:
- SpeciesTreeModel element (exactly one)
- Element named
<tipsDistribution>containing:- ParametricDistributionModel element (exactly one)
- ParametricDistributionModel element (exactly one)
- Element named
<sigma>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<speciesTreePopulationPrior> <speciesTree idref="speciesTree1"/> <tipsDistribution> <normalDistributionModel idref="normalDistributionModel3"/> </tipsDistribution> <sigma> <designMatrix idref="designMatrix3"/> </sigma> </speciesTreePopulationPrior>
<speciesTreeStatistic> element
A statistic that returns true if the given population tree is compatible with the species tree. Compatibility is defined as the compatibility of the timings of the events, so that incompatibility arises if two individuals in the population tree coalescent before their species do in the species tree.
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
The element has the following contents:
- Element named
<speciesTree>containing:- Tree element (exactly one)
- Tree element (exactly one)
- Element named
<populationTree>containing:- Tree element (exactly one)
- Tree element (exactly one)
Example:
<speciesTreeStatistic name="foo"> <speciesTree> <argTreeModel idref="argTreeModel3"/> </speciesTree> <populationTree> <neighborJoiningTree idref="neighborJoiningTree2"/> </populationTree> </speciesTreeStatistic>
<statistic> element
A statistic of a given name from the specified object.
The element takes following attributes:
- Attribute
nameis String- The name of the statistic you wish to extract from the given object
The element has the following contents:
- StatisticList element (exactly one)
Example:
<statistic name="foo"> <expConstExp idref="expConstExp4"/> </statistic>
<STPopulationPrior> element
The element takes following attributes:
- Attribute (optional)
log_rootis Boolean
The element has the following contents:
- SpeciesTreeModel element (exactly one)
- Element named
<tipsDistribution>containing:- ParametricDistributionModel element (exactly one)
- ParametricDistributionModel element (exactly one)
- Element named
<sigma>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<STsigma>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<STPopulationPrior log_root="true"> <speciesTree idref="speciesTree3"/> <tipsDistribution> <normalDistributionModel idref="normalDistributionModel2"/> </tipsDistribution> <STsigma> <duplicatedParameter idref="duplicatedParameter9"/> </STsigma> </STPopulationPrior>
<strictClockBranchRates> element
This element provides a strict clock model. All branches have the same rate of molecular evolution.
The element has the following contents:
- Element named
<rate>containing:- Parameter element (exactly one)
- The molecular evolutionary rate parameter
- Parameter element (exactly one)
Example:
<strictClockBranchRates> <rate> <parameter idref="parameter2"/> </rate> </strictClockBranchRates>
<string> element
returns a String. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned.
The element has the following contents:
- One of:
Example:
<string prompt="Enter the name of a dinosaur:"/>
<subStatistic> element
Allows you to choose specific dimensions of a given statistic
The element takes following attributes:
- Attribute
dimensionis Integer;
The element has the following contents:
- Statistic element (exactly one)
Example:
<subStatistic dimension="1 2 4 8"> <lineageCountStatistic idref="lineageCountStatistic9"/> </subStatistic>
<substitutionEpochModel> element
null
The element has the following contents:
- Element named
<models>containing:- AbstractSubstitutionModel elements (one or more)
- AbstractSubstitutionModel elements (one or more)
- Parameter element (exactly one)
Example:
<substitutionEpochModel> <models> <CovarionHKYModel idref="CovarionHKYModel8"/> <covarionModel idref="covarionModel3"/> <TWOPHASEModel idref="TWOPHASEModel6"/> <msatAvgSubsetModel idref="msatAvgSubsetModel10"/> </models> <compoundParameter idref="compoundParameter9"/> </substitutionEpochModel>
<subtreeSlide> element
An operator that slides a subtree.
The element takes following attributes:
- Attribute
weightis Double - Attribute (optional)
sizeis Double - Attribute (optional)
targetAcceptanceis Double - Attribute
gaussianis Boolean - Attribute (optional)
swapInRandomRateis Boolean - Attribute (optional)
swapInRandomTraitis Boolean - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- TreeModel element (exactly one)
Example:
<subtreeSlide weight="1.0" size="1.0" targetAcceptance="1.0" gaussian="true" swapInRandomRate="true" swapInRandomTrait="true" autoOptimize="true"> <treeModel idref="treeModel1"/> </subtreeSlide>
<sumStatistic> element
This element returns a statistic that is the element-wise sum of the child statistics.
The element takes following attributes:
- Attribute (optional)
elementwiseis Boolean
The element has the following contents:
- Statistic elements (one or more)
Example:
<sumStatistic elementwise="true"> <lineageCountStatistic idref="lineageCountStatistic2"/> </sumStatistic>
<sumStatistic> element
This element returns a statistic that is the element-wise sum of the child statistics.
The element takes following attributes:
- Attribute (optional)
elementwiseis Boolean
The element has the following contents:
- Statistic elements (one or more)
Example:
<sumStatistic elementwise="true"> <popGraph idref="popGraph9"/> <notStatistic idref="notStatistic9"/> <differenceStatistic idref="differenceStatistic4"/> <varianceStatistic idref="varianceStatistic4"/> </sumStatistic>
<generalSubstitutionModel> element
A general reversible model of sequence substitution for any data type.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<rateIndicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<generalSubstitutionModel> <extendedDataType idref="extendedDataType3"/> <frequencies> <frequencyModel idref="frequencyModel1"/> </frequencies> <rates> <compoundParameter idref="compoundParameter1"/> </rates> </generalSubstitutionModel>
<generalSubstitutionModel> element
A general reversible model of sequence substitution for any data type.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<rateIndicator>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<generalSubstitutionModel> <hiddenNucleotides idref="hiddenNucleotides6"/> <frequencies> <frequencyModel idref="frequencyModel10"/> </frequencies> <rates> <diagonalMatrix idref="diagonalMatrix4"/> </rates> </generalSubstitutionModel>
<swapOperator> element
This element represents an operator that swaps values in a multi-dimensional parameter.
The element takes following attributes:
The element has the following contents:
- Parameter element (exactly one)
Example:
<swapOperator weight="1.0" size="1" autoOptimize="true"> <matrixParameter idref="matrixParameter6"/> </swapOperator>
<taxa> element
Defines a set of taxon objects.
The element has the following contents:
Example:
<!-- A list of six taxa --> <taxa id="greatApes"> <taxon id="human"/> <taxon id="chimp"/> <taxon id="bonobo"/> <taxon id="gorilla"/> <taxon id="orangutan"/> <taxon id="siamang"/> </taxa> <!-- A list of three taxa by references to above taxon objects --> <taxa id="humanAndChimps"> <taxon idref="human"/> <taxon idref="chimp"/> <taxon idref="bonobo"/> </taxa>
<taxon> element
The element takes following attributes:
- Attribute
idis String- A unique identifier for this taxon
The element has the following contents:
- Attribute$Default element (zero or one)
- Date element (zero or one)
- Location element (zero or one)
Example:
<taxon id="foo"/>
<teamOperator> element
An arbitrary list of operators; A random subset of size N is aggregated in one operation. Operators may have unequal weights - in that case a subset probability of selection is proportional to the sum of it's members weights.
The element takes following attributes:
The element has the following contents:
- MCMCOperator elements (one or more)
Example:
<teamOperator weight="1.0" size="1"> <treeBitRandomWalk idref="treeBitRandomWalk2"/> <generalizedSkylineGibbsOperator idref="generalizedSkylineGibbsOperator8"/> </teamOperator>
<test> element
This element represents a boolean statistic that returns 1 if the conditions are met and 0 otherwise.
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic, for logging purposes
The element has the following contents:
- Attribute element (exactly one)
- One of:
- Element named
<equals>containing:- Attribute element (exactly one)
- Attribute element (exactly one)
- Element named
<greaterThan>containing:- Attribute element (exactly one)
- Attribute element (exactly one)
- Element named
<lessThan>containing:- Attribute element (exactly one)
- Attribute element (exactly one)
- Attribute
equalsis Double - Attribute
greaterThanis Double - Attribute
lessThanis Double - Attribute
insideis Double; - Attribute
outsideis Double;
- Element named
Example:
<test name="foo"> <parameter idref="parameter7"/> <lessThan> <attr idref="attr10"/> </lessThan> </test>
<threadedCompoundLikelihood> element
A likelihood function which is simply the product of its component likelihood functions.
The element takes following attributes:
- Attribute (optional)
robustWeightis Double
The element has the following contents:
- Likelihood elements (one or more)
Example:
<threadedCompoundLikelihood robustWeight="1.0"> <invgammaPrior idref="invgammaPrior5"/> <normalPrior idref="normalPrior3"/> <speciationLikelihood idref="speciationLikelihood10"/> <multivariateGammaPrior idref="multivariateGammaPrior2"/> </threadedCompoundLikelihood>
<tipHeightLikelihood> element
Calculates the likelihood of the tipHeights given some parametric or empirical distribution.
The element has the following contents:
- Element named
<distribution>containing:- ParametricDistributionModel element (exactly one)
- ParametricDistributionModel element (exactly one)
- Element named
<tipHeights>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<tipHeightLikelihood> <distribution> <inverseGaussianDistributionModel idref="inverseGaussianDistributionModel1"/> </distribution> <tipHeights> <compoundParameter idref="compoundParameter1"/> </tipHeights> </tipHeightLikelihood>
<tipStateSwapOperator> element
This element represents an operator to swap tip states between two random tips.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- TreeLikelihood element (exactly one)
Example:
<tipStateSwapOperator weight="1.0"> <ancestralTreeLikelihood idref="ancestralTreeLikelihood9"/> </tipStateSwapOperator>
<tipTraitSwapOperator> element
This element represents an operator to swap tip traits between two random tips.
The element takes following attributes:
The element has the following contents:
- IntegratedMultivariateTraitLikelihood element (exactly one)
Example:
<tipTraitSwapOperator trait="foo" weight="1.0"> ERROR! </tipTraitSwapOperator>
<tkf91Likelihood> element
Returns the total likelihood of a single alignment under the TKF91 model, for a given tree. In particular all possible ancestral histories of insertions and deletions leading to the alignment of sequences at the tips are taken into account.
The element has the following contents:
- TreeModel element (exactly one)
- Alignment element (exactly one)
- GammaSiteModel element (exactly one)
- TKF91Model element (exactly one)
Example:
<tkf91Likelihood> <treeModel idref="treeModel10"/> <hypermutantAlignment idref="hypermutantAlignment8"/> <siteModel idref="siteModel9"/> <tkf91Model idref="tkf91Model2"/> </tkf91Likelihood>
<tkf91Model> element
The TKF91 (Thorne, Kishino & Felsenstein 1991) model of insertion-deletion.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<lengthDistribution>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<deathRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<tkf91Model units="substitutions"> <lengthDistribution> <matrixParameter idref="matrixParameter4"/> </lengthDistribution> <deathRate> <compoundParameter idref="compoundParameter7"/> </deathRate> </tkf91Model>
<tmrcaStatistic> element
A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
- Attribute (optional)
rateis Boolean
The element has the following contents:
- Tree element (exactly one)
- Element named
<mrca>containing:- Taxa element (exactly one)
- Taxa element (exactly one)
- At least one of:**Attribute (optional)
forParentis Boolean- Attribute (optional)
includeStemis Boolean
Example:
<tmrcaStatistic name="foo" rate="true" forParent="true"> <upgmaTree idref="upgmaTree3"/> <mrca> <taxa idref="taxa4"/> </mrca> </tmrcaStatistic>
<TN93Model> element
This element represents an instance of the TN93 (Tamura and Nei 1993) model of nucleotide evolution.
The element has the following contents:
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<kappa1>containing:- Variable element (exactly one)
- Variable element (exactly one)
- Element named
<kappa2>containing:- Variable element (exactly one)
- Variable element (exactly one)
Example:
<TN93Model> <frequencies> <frequencyModel idref="frequencyModel10"/> </frequencies> <kappa1> <diagonalMatrix idref="diagonalMatrix6"/> </kappa1> <kappa2> <maskedParameter idref="maskedParameter8"/> </kappa2> </TN93Model>
<argPartitionOperator> element
An operator that picks a new partitioning uniformly at random.
The element takes following attributes:
- Attribute
weightis Integer - Attribute (optional)
tossSizeis Integer - Attribute (optional)
tossAllis Boolean
The element has the following contents:
- ARGModel element (exactly one)
Example:
<argPartitionOperator weight="1" tossSize="1" tossAll="true"> <argTreeModel idref="argTreeModel2"/> </argPartitionOperator>
<traceAnalysis> element
Performs a trace analysis. Estimates the mean of the various statistics in the given log file.
The element takes following attributes:
- Attribute
fileNameis String- The name of a BEAST log file (can not include trees, which should be logged separately
- Attribute (optional)
burnInis Integer - Attribute (optional)
stdErroris Boolean - Attribute (optional)
computeMSEis Boolean
The element has the following contents:
Example:
<traceAnalysis fileName="foo" burnIn="1" stdError="true" computeMSE="true"> <expectation name="foo" value="foo"/> <expectation name="foo" value="foo"/> <expectation name="foo" value="foo"/> </traceAnalysis>
<traitGibbsOperator> element
This element returns a multivariate Gibbs operator on traits for possible all nodes.
The element takes following attributes:
- Attribute
weightis Double - Attribute (optional)
onlyInternalNodesis Boolean - Attribute (optional)
onlyTipsWithPriorsis Boolean
The element has the following contents:
- SampledMultivariateTraitLikelihood element (exactly one)
- MultivariateDistributionLikelihood elements (zero or more)
- Element named
<rootPrior>containing:- MultivariateDistributionLikelihood element (exactly one)
- MultivariateDistributionLikelihood element (exactly one)
- GeoSpatialCollectionModel element (zero or one)
Example:
<traitGibbsOperator weight="1.0" onlyInternalNodes="true" onlyTipsWithPriors="true"> ERROR! <multivariateNormalPrior idref="multivariateNormalPrior2"/> </traitGibbsOperator>
<traitRateGibbsOperator> element
This element returns a multivariate Gibbs operator on traits for possible all nodes.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- AbstractMultivariateTraitLikelihood element (exactly one)
- ArbitraryBranchRates element (exactly one)
- DistributionLikelihood element (exactly one)
Example:
<traitRateGibbsOperator weight="1.0"> <inhibitionLikelihood idref="inhibitionLikelihood3"/> <arbitraryBranchRates idref="arbitraryBranchRates9"/> <modelSpecificPseudoPrior idref="modelSpecificPseudoPrior1"/> </traitRateGibbsOperator>
<tree> element
This element represents a rooted binary tree and associated attributes.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- SimpleNode element (exactly one)
Example:
<tree units="substitutions"> <node idref="node9"/> </tree>
<treeBitMoveOperator> element
This element returns a bit-move operator on a given parameter.
The element takes following attributes:
- Attribute
weightis Double - Attribute (optional)
indicatorTraitis String - Attribute (optional)
trait2is String
The element has the following contents:
- TreeModel element (exactly one)
Example:
<treeBitMoveOperator weight="1.0" indicatorTrait="foo" trait2="foo"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1"/> </treeBitMoveOperator>
<treeBitRandomWalk> element
This element returns a bit-random walk operator on a random indicator/variable pair in the tree.
The element takes following attributes:
- Attribute
weightis Double - Attribute (optional)
indicatorTraitis String - Attribute (optional)
trait2is String - Attribute (optional)
swapTrait2is Boolean - Attribute (optional)
kis Integer
The element has the following contents:
- TreeModel element (exactly one)
Example:
<treeBitRandomWalk weight="1.0" indicatorTrait="foo" trait2="foo" swapTrait2="true" k="1"> <treeModel idref="treeModel1"/> </treeBitRandomWalk>
<diffusionRateStatistic> element
A statistic that returns the average of the branch rates
The element takes following attributes:
The element has the following contents:
- AbstractMultivariateTraitLikelihood elements (one or more)
Example:
<diffusionRateStatistic name="foo" greatCircleDistance="true"> <inhibitionLikelihood idref="inhibitionLikelihood7"/> <multivariateTraitLikelihood idref="multivariateTraitLikelihood6"/> <multivariateTraitLikelihood idref="multivariateTraitLikelihood7"/> </diffusionRateStatistic>
<treeLengthStatistic> element
A statistic that returns the average of the branch rates
The element takes following attributes:
- Attribute (optional)
nameis String
The element has the following contents:
- TreeModel element (exactly one)
Example:
<treeLengthStatistic name="foo"> <treeModel idref="treeModel8"/> </treeLengthStatistic>
<treeLikelihood> element
This element represents the likelihood of a patternlist on a tree given the site model.
The element takes following attributes:
- Attribute (optional)
useAmbiguitiesis Boolean - Attribute (optional)
allowMissingTaxais Boolean - Attribute (optional)
storePartialsis Boolean - Attribute (optional)
forceJavaCoreis Boolean - Attribute (optional)
forceRescalingis Boolean
The element has the following contents:
- PatternList element (exactly one)
- TreeModel element (exactly one)
- SiteModel element (exactly one)
- BranchRateModel element (zero or one)
- TipPartialsModel element (zero or one)
Example:
<treeLikelihood useAmbiguities="true" allowMissingTaxa="true" storePartials="true" forceJavaCore="true" forceRescaling="true"> <mergePatterns idref="mergePatterns2"/> <treeModel idref="treeModel2"/> <siteModel idref="siteModel8"/> </treeLikelihood>
<treeMetricStatistic> element
A statistic that returns the distance between two trees. with method="topology", return a 0 for identity and a 1 for difference. With other methods return the distance metric associated with that method.
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
- Attribute (optional)
methodis String- comparision method (TOPOLOGY,BILLERA,ROBINSONSFOULD,CLADEHEIGHTM,BRANCHSCORE,CLADEMETRIC)
The element has the following contents:
- Element named
<target>containing:- Tree element (exactly one)
- Tree element (exactly one)
- Element named
<reference>containing:- Tree element (exactly one)
- Tree element (exactly one)
Example:
<treeMetricStatistic name="foo" method="foo"> <target> <newick idref="newick8"/> </target> <reference> <argTreeModel idref="argTreeModel8"/> </reference> </treeMetricStatistic>
<treeModel> element
This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.
The element has the following contents:
- Tree element (exactly one)
- Element named
<rootHeight>containing:- Parameter element (exactly one)
- A parameter definition with id only (cannot be a reference!)
- Parameter element (exactly one)
- Element named
<nodeHeights>containing:- Attribute (optional)
rootNodeis Boolean- If true the root height is included in the parameter
- Attribute (optional)
internalNodesis Boolean- If true the internal node heights (minus the root) are included in the parameter
- Parameter element (exactly one)
- A parameter definition with id only (cannot be a reference!)
- Attribute (optional)
- Element named
<leafHeight>containing: - Element named
<nodeTraits>containing:- Attribute
nameis String- The name of the trait attribute in the taxa
- Attribute (optional)
rootNodeis Boolean- If true the root trait is included in the parameter
- Attribute (optional)
internalNodesis Boolean- If true the internal node traits (minus the root) are included in the parameter
- Attribute (optional)
leafNodesis Boolean- If true the leaf node traits are included in the parameter
- Attribute (optional)
traitDimensionis Integer- The number of dimensions (if multivariate)
- Attribute (optional)
initialValueis Double- The initial value(s)
- Attribute (optional)
fireTreeEventsis Boolean- Whether to fire tree events if the traits change
- Parameter element (exactly one)
- A parameter definition with id only (cannot be a reference!)
- Attribute
- Element named
<nodeRates>containing:- Attribute (optional)
rootNodeis Boolean- If true the root rate is included in the parameter
- Attribute (optional)
internalNodesis Boolean- If true the internal node rate (minus the root) are included in the parameter
- Attribute (optional)
leafNodesis Boolean- If true the leaf node rate are included in the parameter
- Attribute (optional)
initialValueis Double- The initial value(s)
- Parameter element (exactly one)
- A parameter definition with id only (cannot be a reference!)
- Attribute (optional)
- Element named
<leafTrait>containing:
Example:
<!-- the tree model as special sockets for attaching parameters to various aspects of the tree --> <!-- The treeModel below shows the standard setup with a parameter associated with the root height --> <!-- a parameter associated with the internal node heights (minus the root height) and --> <!-- a parameter associates with all the internal node heights --> <!-- Notice that these parameters are overlapping --> <!-- The parameters are subsequently used in operators to propose changes to the tree node heights --> <treeModel id="treeModel1"> <tree idref="startingTree"/> <rootHeight> <parameter id="treeModel1.rootHeight"/> </rootHeight> <nodeHeights internalNodes="true" rootNode="false"> <parameter id="treeModel1.internalNodeHeights"/> </nodeHeights> <nodeHeights internalNodes="true" rootNode="true"> <parameter id="treeModel1.allInternalNodeHeights"/> </nodeHeights> </treeModel>
<treeShapeStatistics> element
A statistic that reports a handful of tree shape statistics on the given target tree.
The element takes following attributes:
- Attribute (optional)
nameis String- A name for this statistic primarily for the purposes of logging
The element has the following contents:
- Element named
<target>containing:- TreeModel element (exactly one)
- TreeModel element (exactly one)
Example:
<treeShapeStatistics name="foo"> <target> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel7"/> </target> </treeShapeStatistics>
<treeTraceAnalysis> element
Analyses and reports on a trace consisting of trees.
The element takes following attributes:
- Attribute
fileNameis String- name of a tree log file
- Attribute (optional)
burnInis Integer - Attribute (optional)
minCladeProbabilityis Double - Attribute (optional)
credSetProbabilityis Double - Attribute (optional)
shortReportis Boolean - Attribute (optional)
referenceTreeis String
Example:
<treeTraceAnalysis fileName="trees.log" burnIn="1" minCladeProbability="1.0" credSetProbability="1.0" shortReport="true" referenceTree="foo"/>
<treeUniform> element
Simultanouesly change height of two nodes.
The element takes following attributes:
The element has the following contents:
- TreeModel element (exactly one)
Example:
<treeUniform weight="1.0" count="1"> <treeModel idref="treeModel5"/> </treeUniform>
<twoEpoch> element
A demographic model of two epochs.
The element takes following attributes:
- Attribute
unitsis String- the units
The element has the following contents:
- Element named
<modernEpoch>containing:- DemographicModel element (exactly one)
- The demographic model for the recent epoch.
- DemographicModel element (exactly one)
- Element named
<ancientEpoch>containing:- DemographicModel element (exactly one)
- The demographic model for the ancient epoch.
- DemographicModel element (exactly one)
- Element named
<transitionTime>containing:- Parameter element (exactly one)
- The time that splits the two epochs.
- Parameter element (exactly one)
Example:
<twoEpoch units="substitutions"> <modernEpoch> <constantExponential idref="constantExponential3"/> </modernEpoch> <ancientEpoch> <constantExponential idref="constantExponential6"/> </ancientEpoch> <transitionTime> <designMatrix idref="designMatrix5"/> </transitionTime> </twoEpoch>
<twoPartDistribution> element
Calculates the likelihood of some data given some parametric or empirical distribution.
Example:
<twoPartDistribution/>
<TWOPHASEModel> element
This element represents an instance of the Two Phase Model of microsatellite evolution.
The element takes following attributes:
- Attribute (optional)
estimateSubmodelParametersis String- whether or not to esitmate the parameters of the submodel
The element has the following contents:
- Microsatellite element (exactly one)
- Element named
<frequencies>containing:- FrequencyModel element (exactly one)
- FrequencyModel element (exactly one)
- Element named
<Submodel>containing:- OnePhaseModel element (exactly one)
- OnePhaseModel element (exactly one)
- Element named
<OnePhasePrParam>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<GeoParam>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<TransformParam>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<TWOPHASEModel estimateSubmodelParameters="foo"> <microsatellite idref="microsatellite8"/> <Submodel> <LINEARBIASModel idref="LINEARBIASModel7"/> </Submodel> <OnePhasePrParam> <matrixParameter idref="matrixParameter6"/> </OnePhasePrParam> <GeoParam> <maskedParameter idref="maskedParameter5"/> </GeoParam> </TWOPHASEModel>
<UCLikelihood> element
This element returns an object that can calculate the likelihood of rates in a tree under the assumption of (log)normally distributed rates.
The element takes following attributes:
- Attribute (optional)
logspaceis Boolean- true if model considers the log of the rates.
The element has the following contents:
- TreeModel element (exactly one)
- Element named
<rates>containing:- Parameter element (exactly one)
- The branch rates parameter
- Parameter element (exactly one)
- Element named
<rootRate>containing:- Parameter element (exactly one)
- The root rate parameter
- Parameter element (exactly one)
- Element named
<variance>containing:- Parameter element (exactly one)
- The standard deviation of the (log)normal distribution
- Parameter element (exactly one)
Example:
<UCLikelihood logspace="true"> <treeModel idref="treeModel1"/> <rates> <matrixParameter idref="matrixParameter3"/> </rates> <rootRate> <diagonalMatrix idref="diagonalMatrix2"/> </rootRate> <variance> <compoundSymmetricMatrix idref="compoundSymmetricMatrix5"/> </variance> </UCLikelihood>
<uniformDistributionModel> element
Describes a uniform distribution with a given lower and upper bounds
The element has the following contents:
- Element named
<lower>containing:
- Element named
<upper>containing:
Example:
<uniformDistributionModel> <lower> 1.0 </lower> <upper> 1.0 </upper> </uniformDistributionModel>
<uniformIntegerOperator> element
An operator that picks new parameter values uniformly at random.
The element takes following attributes:
- Attribute
weightis Double - Attribute (optional)
upperis Double - Attribute (optional)
loweris Double - Attribute (optional)
countis Double
The element has the following contents:
- Parameter element (exactly one)
Example:
<uniformIntegerOperator weight="1.0" upper="1.0" lower="1.0" count="1.0"> <duplicatedParameter idref="duplicatedParameter8"/> </uniformIntegerOperator>
<uniformNodeHeightPrior> element
This element represents the likelihood of the tree given the demographic function.
The element takes following attributes:
- Attribute (optional)
analyticis Boolean - Attribute (optional)
maxRootHeightis Double - Attribute (optional)
mcSampleSizeis Integer - Attribute (optional)
marginalis Boolean - Attribute (optional)
approximateis Boolean
The element has the following contents:
- TreeModel element (exactly one)
Example:
<uniformNodeHeightPrior analytic="true" maxRootHeight="1.0" mcSampleSize="1" marginal="true" approximate="true"> <treeModel idref="treeModel9"/> </uniformNodeHeightPrior>
<uniformOperator> element
An operator that picks new parameter values uniformly at random.
The element takes following attributes:
- Attribute
weightis Double - Attribute (optional)
loweris Double - Attribute (optional)
upperis Double
The element has the following contents:
- Parameter element (exactly one)
Example:
<uniformOperator weight="1.0" lower="1.0" upper="1.0"> <duplicatedParameter idref="duplicatedParameter8"/> </uniformOperator>
<uniformPartitionLikelihood> element
null
The element has the following contents:
- ARGModel element (exactly one)
Example:
<uniformPartitionLikelihood> <argTreeModel idref="argTreeModel8"/> </uniformPartitionLikelihood>
<uniformPrior> element
Calculates the prior probability of some data under a given uniform distribution.
The element takes following attributes:
The element has the following contents:
- Statistic elements (one or more)
Example:
<uniformPrior lower="1.0" upper="1.0"> <speciesTreeStatistic idref="speciesTreeStatistic3"/> <logarithmStatistic idref="logarithmStatistic4"/> </uniformPrior>
<uniformNodeHeightPrior> element
This element represents the likelihood of the tree given the demographic function.
The element takes following attributes:
- Attribute (optional)
analyticis Boolean - Attribute (optional)
maxRootHeightis Double - Attribute (optional)
mcSampleSizeis Integer - Attribute (optional)
marginalis Boolean - Attribute (optional)
approximateis Boolean
The element has the following contents:
- TreeModel element (exactly one)
Example:
<uniformNodeHeightPrior analytic="true" maxRootHeight="1.0" mcSampleSize="1" marginal="true" approximate="true"> <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel10"/> </uniformNodeHeightPrior>
<upDownOperator> element
This element represents an operator that scales two parameters in different directions. Each operation involves selecting a scale uniformly at random between scaleFactor and 1/scaleFactor. The up parameter is multipled by this scale and the down parameter is divided by this scale.
The element takes following attributes:
- Attribute
scaleFactoris Double - Attribute
weightis Double - Attribute (optional)
autoOptimizeis Boolean
The element has the following contents:
- Element named
<up>containing: - Element named
<down>containing:
Example:
<upDownOperator scaleFactor="1.0" weight="1.0" autoOptimize="true"> <up/> <up/> <down/> <down/> </upDownOperator>
<upgmaTree> element
This element returns a UPGMA tree generated from the given distances.
The element takes following attributes:
The element has the following contents:
- DistanceMatrix element (exactly one)
Example:
<upgmaTree usingDates="true" rootHeight="1.0"> <distanceMatrix idref="distanceMatrix9"/> </upgmaTree>
<variableDemographic> element
This element represents the likelihood of the tree given the population size vector.
The element takes following attributes:
- Attribute (optional)
typeis String - Attribute (optional)
logUnitsis Boolean - Attribute (optional)
useMidpointsis Boolean
The element has the following contents:
- Element named
<populationSizes>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<indicators>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<trees>containing:
Example:
<variableDemographic type="foo" logUnits="true" useMidpoints="true">
<populationSizes>
<designMatrix idref="designMatrix4"/>
</populationSizes>
<indicators>
<diagonalMatrix idref="diagonalMatrix4"/>
</indicators>
<trees>
<ptree ploidy="1.0">
<treeModel idref="treeModel10"/>
</ptree>
<ptree ploidy="1.0">
<treeModel idref="treeModel2"/>
</ptree>
<ptree ploidy="1.0">
<treeModel idref="treeModel8"/>
</ptree>
</trees>
</variableDemographic>
<varianceStatistic> element
This element returns a statistic that is the variance of the child statistics.
The element has the following contents:
- Statistic elements (one or more)
Example:
<varianceStatistic> <gmrfPopSizeStatistic idref="gmrfPopSizeStatistic7"/> <gmrfPopSizeStatistic idref="gmrfPopSizeStatistic9"/> <externalLengthStatistic idref="externalLengthStatistic9"/> </varianceStatistic>
<VDAnalysis> element
reconstruct population graph from EBSP run.
The element takes following attributes:
- Attribute (optional)
burnInis Double- The number of states (not sampled states, but actual states) that are discarded from the beginning of the trace and are excluded from the analysis
- Attribute (optional)
Confidencelevelsis Double; - Attribute (optional)
useQuantilesis Boolean - Attribute (optional)
logUnitsis Boolean - Attribute (optional)
useMidpointsis Boolean - Attribute (optional)
nBinsis Integer - Attribute (optional)
nChangesis Integer
The element has the following contents:
- Element named
<logFileName>containing:- String element (exactly one)
- The name of a BEAST log file
- String element (exactly one)
- Element named
<treeFileNames>containing:- Element named
<treeOfLoci>containing:- String element (exactly one)
- The name of a BEAST trees log file
- String element (exactly one)
- Element named
- Element named
<populationModelType>containing:- String element (exactly one)
- population model type (stepwise, linear ...
- String element (exactly one)
- Element named
<populationFirstColumn>containing:- String element (exactly one)
- Name of first column of population size
- String element (exactly one)
- Element named
<indicatorsFirstColumn>containing:- String element (exactly one)
- Name of first column of population indicators
- String element (exactly one)
- Element named
<rootheightColumn>containing:- String element (exactly one)
- Name of trace column of root height
- String element (exactly one)
- Element named
<allDemographicsFileName>containing:- String element (exactly one)
- Name of file to output all demographic functions
- String element (exactly one)
Example:
<VDAnalysis burnIn="1.0" Confidencelevels="0.5 1.0" useQuantiles="true" logUnits="true" useMidpoints="true" nBins="1" nChanges="1">
<logFileName>
foo
</logFileName>
<treeFileNames>
<treeOfLoci>
foo
</treeOfLoci>
<treeOfLoci>
foo
</treeOfLoci>
</treeFileNames>
<populationModelType>
foo
</populationModelType>
<populationFirstColumn>
foo
</populationFirstColumn>
<indicatorsFirstColumn>
foo
</indicatorsFirstColumn>
</VDAnalysis>
<wideExchange> element
This element represents a wide exchange operator. This operator swaps two random subtrees.
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- TreeModel element (exactly one)
Example:
<wideExchange weight="1.0"> <treeModel idref="treeModel10"/> </wideExchange>
<wilsonBalding> element
An operator which performs the Wilson-Balding move on a tree
The element takes following attributes:
- Attribute
weightis Double
The element has the following contents:
- TreeModel element (exactly one)
Example:
<wilsonBalding weight="1.0"> <treeModel idref="treeModel2"/> </wilsonBalding>
<yangCodonModel> element
This element represents the Yang model of codon evolution.
The element takes following attributes:
- Attribute (optional)
geneticCodeis String- The genetic code to use
The element has the following contents:
- Element named
<omega>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- Element named
<kappa>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
- FrequencyModel element (exactly one)
Example:
<yangCodonModel geneticCode="flatwormMitochondrial"> <omega> <parameter idref="parameter9"/> </omega> <kappa> <designMatrix idref="designMatrix7"/> </kappa> <frequencyModel idref="frequencyModel7"/> </yangCodonModel>
<yuleModel> element
A speciation model of a simple constant rate Birth-death process.
The element takes following attributes:
The element has the following contents:
- Element named
<birthRate>containing:- Parameter element (exactly one)
- Parameter element (exactly one)
Example:
<yuleModel conditionalOnRoot="true" units="substitutions"> <birthRate> <designMatrix idref="designMatrix7"/> </birthRate> </yuleModel>
BEAST types
The following is a list of generic types that elements represent in a beast file.
ARGModel
Elements of this type include:
ARGPartitionLikelihood
Elements of this type include:
ARGRatePrior
Elements of this type include:
AbstractDistributionLikelihood
Elements of this type include:
AbstractMultivariateTraitLikelihood
Elements of this type include:
AbstractSubstitutionModel
Elements of this type include:
Alignment
Elements of this type include:
ArbitraryBranchRates
Elements of this type include:
Attribute
Elements of this type include:
- RPNcalculator
- argReassortmentNodeCount
- argTimingStatistic
- argTotalLengthStatistic
- argTreeCount
- attr
- coalescentIntervalStatistic
- compatibilityStatistic
- compoundParameter
- compoundSymmetricMatrix
- correlation
- date
- designMatrix
- diagonalMatrix
- differenceStatistic
- duplicatedParameter
- exponentialStatistic
- expressionStatistic
- externalLengthStatistic
- generalizedSkylinePopSizeStatistic
- gmrfHeightsStatistic
- gmrfPopSizeStatistic
- lineageCountStatistic
- logarithmStatistic
- loggableStatistic
- maskedParameter
- matrixParameter
- meanStatistic
- monophylyStatistic
- monotonicStatistic
- mrcaTraitStatistic
- multivariateOUModel
- negativeStatistic
- nodeHeightsStatistic
- notStatistic
- parameter
- parsimonyStateStatistic
- parsimonyStatistic
- partitionStatistic
- popGraph
- productStatistic
- rateCovarianceStatistic
- rateStatistic
- ratioStatistic
- reciprocalStatistic
- speciesTreeStatistic
- statistic
- subStatistic
- sumStatistic
- test
- tmrcaStatistic
- treeLengthStatistic
- treeMetricStatistic
- treeShapeStatistics
- varianceStatistic
Attribute$Default
Elements of this type include:
BayesianSkylineLikelihood
Elements of this type include:
BayesianStochasticSearchVariableSelection
Elements of this type include:
Boolean
Elements of this type include:
BooleanStatistic
Elements of this type include:
BranchRateModel
Elements of this type include:
- ACLikelihood
- UCLikelihood
- arbitraryBranchRates
- argDiscretizedBranchRates
- argLocalClock
- compoundBranchRateModel
- continuousTraitRateModel
- discreteTraitRateModel
- discretizedBranchRates
- localClockModel
- mixtureModelBranchRates
- randomDiscretizedBranchRates
- randomLocalClockModel
- rateEpochBranchRates
- scaledTreeLengthModel
- strictClockBranchRates
BranchRates
Elements of this type include:
- ACLikelihood
- UCLikelihood
- arbitraryBranchRates
- argDiscretizedBranchRates
- argLocalClock
- compoundBranchRateModel
- continuousTraitRateModel
- discreteTraitRateModel
- discretizedBranchRates
- localClockModel
- mixtureModelBranchRates
- randomDiscretizedBranchRates
- randomLocalClockModel
- rateEpochBranchRates
- scaledTreeLengthModel
- strictClockBranchRates
BranchingModel
Elements of this type include:
ColourSamplerModel
Elements of this type include:
Columns
Elements of this type include:
CompoundParameter
Elements of this type include:
DataType
Elements of this type include:
Date
Elements of this type include:
DemographicModel
Elements of this type include:
DesignMatrix
Elements of this type include:
DistanceMatrix
Elements of this type include:
Distribution
Elements of this type include:
DistributionLikelihood
Elements of this type include:
Double
Elements of this type include:
Double;
Elements of this type include:
EmpiricalTreeDistributionModel
Elements of this type include:
FrequencyModel
Elements of this type include:
GMRFSkyrideLikelihood
Elements of this type include:
GammaSiteModel
Elements of this type include:
GeneralizedLinearModel
Elements of this type include:
GeoSpatialCollectionModel
Elements of this type include:
HypermutantAlignment
Elements of this type include:
Identifiable
Elements of this type include:
- ACLikelihood
- ASYMQUADModel
- BrownianMotion
- CovarionHKYModel
- DirichletSiteModel
- HKYModel
- LINEARBIASModel
- MutationDeathModel
- Ornstein-Uhlenbeck
- RPNcalculator
- STPopulationPrior
- TN93Model
- TWOPHASEModel
- UCLikelihood
- alignment
- alsTreeLikelihood
- aminoAcidModel
- ancestralTreeLikelihood
- anyTipObservationProcess
- arbitraryBranchRates
- argCoalescentLikelihood
- argDiscretizedBranchRates
- argLocalClock
- argRatePrior
- argReassortmentNodeCount
- argTimingStatistic
- argTotalLengthStatistic
- argTreeCount
- argTreeLikelihood
- argTreeModel
- argUniformPrior
- ascertainedPatterns
- attributePatterns
- avgPosteriorIBDReporter
- benchmarker
- betaSplittingModel
- binaryCovarionModel
- binarySubstitutionModel
- binomialLikelihood
- birthDeathModel
- booleanLikelihood
- branchingLikelihood
- cachedPrior
- cartogramDiffusionModel
- cataclysm
- categorySiteModel
- coalescentIntervalStatistic
- coalescentLikelihood
- compatibilityStatistic
- compoundBranchRateModel
- compoundLikelihood
- compoundParameter
- compoundSymmetricMatrix
- constExpConst
- constantExponential
- constantLogistic
- constantSize
- continuousTraitRateModel
- convert
- correlation
- covarionModel
- ctmcScalePrior
- designMatrix
- diagonalMatrix
- differenceStatistic
- dirichletPrior
- discreteTraitRateModel
- discretizedBranchRates
- distanceMatrix
- distributionLikelihood
- dummyLikelihood
- dummyModel
- duplicatedParameter
- empiricalDistributionLikelihood
- empiricalPiecewise
- empiricalTreeDistributionModel
- expConstExp
- expansion
- exponentialBranchLengthsPrior
- exponentialDistributionModel
- exponentialGrowth
- exponentialLogistic
- exponentialMarkovLikelihood
- exponentialPrior
- exponentialSawtooth
- exponentialStatistic
- expressionStatistic
- externalLengthStatistic
- flatGeoSpatialPrior
- frequencyModel
- gammaDistributionModel
- gammaPrior
- generalizedSkyLineLikelihood
- generalizedSkylinePopSizeStatistic
- glmModel
- glmSubstitutionModel
- gmrfHeightsStatistic
- gmrfPopSizeStatistic
- gmrfSkyrideLikelihood
- gmrfTestLikelihood
- greatCircleDiffusionModel
- gtrCovarionModel
- gtrModel
- hierarchicalPartitionLikelihood
- hypermutantAlignment
- hypermutantErrorModel
- ibdReporter
- inhibitionLikelihood
- inverseGaussianDistributionModel
- invgammaPrior
- laplacePrior
- lewisMk
- lineageCountStatistic
- localClockModel
- location
- logNormalDistributionModel
- logNormalPrior
- logarithmStatistic
- loggableStatistic
- logisticGrowth
- maskedParameter
- matrixParameter
- mcmc
- meanStatistic
- mergePatterns
- microsatellitePattern
- microsatelliteSamplerTreeLikelihood
- microsatelliteSamplerTreeModel
- microsatelliteSimulator
- mixedDistributionLikelihood
- mixtureCartogramDiffusionModel
- mixtureModel
- mixtureModelBranchRates
- mkSubstitutionModel
- modelSpecificPseudoPrior
- monophylyStatistic
- monotonicStatistic
- mrcaTraitStatistic
- msatAvgSubsetModel
- multivariateDiffusionModel
- multivariateGammaPrior
- multivariateInverseWishartPrior
- multivariateNormalPrior
- multivariateOUModel
- multivariateTDiffusionModel
- multivariateTraitLikelihood
- multivariateWishartPrior
- negativeStatistic
- neighborJoiningTree
- newick
- nodeHeightsStatistic
- nodePosteriorLikelihood
- normalDistributionModel
- normalPrior
- notStatistic
- oneOnXPrior
- onePGammaDistributionModel
- optimizer
- ovariableSkyLineLikelihood
- parameter
- parsimonyStateStatistic
- parsimonyStatistic
- partitionStatistic
- patternSubSet
- patterns
- piecewisePopulation
- poissonPartitionLikelihood
- poissonPrior
- popGraph
- positiveDefiniteSubstitutionModel
- productStatistic
- randomDiscretizedBranchRates
- randomLocalClockModel
- randomLocalYuleModel
- randomWalk
- rateCovarianceStatistic
- rateEpochBranchRates
- rateStatistic
- ratioStatistic
- reciprocalStatistic
- sampleStateAndCategoryModel
- sampleStateModel
- scaledPiecewisePopulation
- scaledTreeLengthModel
- sequence
- sequenceErrorModel
- sequenceSimulator
- singleTipObservationProcess
- siteModel
- sp
- speciationLikelihood
- species
- speciesCoalescent
- speciesTree
- speciesTreePopulationPrior
- speciesTreeStatistic
- statistic
- strictClockBranchRates
- subStatistic
- substitutionEpochModel
- sumStatistic
- taxa
- taxon
- test
- threadedCompoundLikelihood
- tipHeightLikelihood
- tkf91Likelihood
- tkf91Model
- tmrcaStatistic
- tree
- treeLengthStatistic
- treeLikelihood
- treeMetricStatistic
- treeModel
- treeShapeStatistics
- twoEpoch
- twoPartDistribution
- uniformDistributionModel
- uniformNodeHeightPrior
- uniformPartitionLikelihood
- uniformPrior
- upgmaTree
- variableDemographic
- varianceStatistic
- yangCodonModel
- yuleModel
Integer
Elements of this type include:
Integer;
Elements of this type include:
IntegratedMultivariateTraitLikelihood
Elements of this type include:
KMLCoordinates
Elements of this type include:
Likelihood
Elements of this type include:
- ACLikelihood
- ASYMQUADModel
- BrownianMotion
- LINEARBIASModel
- Ornstein-Uhlenbeck
- STPopulationPrior
- TWOPHASEModel
- UCLikelihood
- alsTreeLikelihood
- ancestralTreeLikelihood
- arbitraryBranchRates
- argCoalescentLikelihood
- argDiscretizedBranchRates
- argLocalClock
- argRatePrior
- argTreeLikelihood
- argUniformPrior
- avgPosteriorIBDReporter
- benchmarker
- binomialLikelihood
- booleanLikelihood
- branchingLikelihood
- cachedPrior
- coalescentLikelihood
- compoundBranchRateModel
- compoundLikelihood
- continuousTraitRateModel
- ctmcScalePrior
- dirichletPrior
- discreteTraitRateModel
- discretizedBranchRates
- distributionLikelihood
- dummyLikelihood
- dummyModel
- empiricalDistributionLikelihood
- exponentialBranchLengthsPrior
- exponentialMarkovLikelihood
- exponentialPrior
- flatGeoSpatialPrior
- gammaPrior
- generalizedSkyLineLikelihood
- glmModel
- gmrfSkyrideLikelihood
- gmrfTestLikelihood
- hierarchicalPartitionLikelihood
- ibdReporter
- inhibitionLikelihood
- invgammaPrior
- laplacePrior
- localClockModel
- logNormalPrior
- microsatelliteSamplerTreeLikelihood
- mixedDistributionLikelihood
- mixtureModelBranchRates
- modelSpecificPseudoPrior
- msatAvgSubsetModel
- multivariateGammaPrior
- multivariateInverseWishartPrior
- multivariateNormalPrior
- multivariateOUModel
- multivariateTraitLikelihood
- multivariateWishartPrior
- nodePosteriorLikelihood
- normalPrior
- oneOnXPrior
- ovariableSkyLineLikelihood
- poissonPartitionLikelihood
- poissonPrior
- randomDiscretizedBranchRates
- randomLocalClockModel
- randomWalk
- rateEpochBranchRates
- scaledTreeLengthModel
- speciationLikelihood
- speciesCoalescent
- speciesTreePopulationPrior
- strictClockBranchRates
- threadedCompoundLikelihood
- tipHeightLikelihood
- tkf91Likelihood
- treeLikelihood
- twoPartDistribution
- uniformNodeHeightPrior
- uniformPartitionLikelihood
- uniformPrior
LinearRegression
Elements of this type include:
Location
Elements of this type include:
Loggable
Elements of this type include:
- ACLikelihood
- ASYMQUADModel
- BrownianMotion
- LINEARBIASModel
- Ornstein-Uhlenbeck
- RPNcalculator
- STPopulationPrior
- TWOPHASEModel
- UCLikelihood
- alsTreeLikelihood
- ancestralTrait
- ancestralTreeLikelihood
- arbitraryBranchRates
- argCoalescentLikelihood
- argDiscretizedBranchRates
- argLocalClock
- argRatePrior
- argReassortmentNodeCount
- argTimingStatistic
- argTotalLengthStatistic
- argTreeCount
- argTreeLikelihood
- argTreeModel
- argUniformPrior
- avgPosteriorIBDReporter
- benchmarker
- binomialLikelihood
- booleanLikelihood
- branchingLikelihood
- cachedPrior
- coalescentIntervalStatistic
- coalescentLikelihood
- compatibilityStatistic
- compoundBranchRateModel
- compoundLikelihood
- compoundParameter
- compoundSymmetricMatrix
- continuousTraitRateModel
- correlation
- ctmcScalePrior
- designMatrix
- diagonalMatrix
- differenceStatistic
- dirichletPrior
- discreteTraitRateModel
- discretizedBranchRates
- distributionLikelihood
- dummyLikelihood
- dummyModel
- duplicatedParameter
- empiricalDistributionLikelihood
- exponentialBranchLengthsPrior
- exponentialMarkovLikelihood
- exponentialPrior
- exponentialStatistic
- expressionStatistic
- externalLengthStatistic
- flatGeoSpatialPrior
- gammaPrior
- generalizedSkyLineLikelihood
- generalizedSkylinePopSizeStatistic
- glmModel
- gmrfHeightsStatistic
- gmrfPopSizeStatistic
- gmrfSkyrideLikelihood
- gmrfTestLikelihood
- hierarchicalPartitionLikelihood
- ibdReporter
- inhibitionLikelihood
- invgammaPrior
- laplacePrior
- lineageCountStatistic
- localClockModel
- logNormalPrior
- logarithmStatistic
- loggableStatistic
- maskedParameter
- matrixParameter
- meanStatistic
- microsatelliteSamplerTreeLikelihood
- mixedDistributionLikelihood
- mixtureModelBranchRates
- modelSpecificPseudoPrior
- monophylyStatistic
- monotonicStatistic
- mrcaTraitStatistic
- msatAvgSubsetModel
- multivariateGammaPrior
- multivariateInverseWishartPrior
- multivariateNormalPrior
- multivariateOUModel
- multivariateTraitLikelihood
- multivariateWishartPrior
- negativeStatistic
- nodeHeightsStatistic
- nodePosteriorLikelihood
- normalPrior
- notStatistic
- oneOnXPrior
- operators
- ovariableSkyLineLikelihood
- parameter
- parsimonyStateStatistic
- parsimonyStatistic
- partitionStatistic
- poissonPartitionLikelihood
- poissonPrior
- popGraph
- positiveDefiniteSubstitutionModel
- productStatistic
- randomDiscretizedBranchRates
- randomLocalClockModel
- randomWalk
- rateCovarianceStatistic
- rateEpochBranchRates
- rateStatistic
- ratioStatistic
- reciprocalStatistic
- scaledTreeLengthModel
- speciationLikelihood
- speciesCoalescent
- speciesTreePopulationPrior
- speciesTreeStatistic
- statistic
- strictClockBranchRates
- subStatistic
- sumStatistic
- test
- threadedCompoundLikelihood
- tipHeightLikelihood
- tkf91Likelihood
- tmrcaStatistic
- treeLengthStatistic
- treeLikelihood
- treeMetricStatistic
- treeShapeStatistics
- twoPartDistribution
- uniformNodeHeightPrior
- uniformPartitionLikelihood
- uniformPrior
- varianceStatistic
Logger
Elements of this type include:
MCMCOperator
Elements of this type include:
- ARGEventOperator
- FixedNodeheightSubtreePruneRegraft
- GibbsPruneAndRegraft
- GibbsSubtreeSwap
- ImportanceNarrowExchange
- ImportancePruneAndRegraft
- ImportanceSubtreeSwap
- NearestNeighborInterchange
- addremoveARGEvent
- alignmentChunkOperator
- argNarrowExchange
- argPartitionOperator
- argSubtreeSlide
- argSwapOperator
- argWideExchange
- bitFlipInSubstitutionModelOperator
- bitFlipOperator
- bitMoveOperator
- bitSwapOperator
- centeredScale
- deltaExchange
- dirtyLikelihood
- discretizedLocationOperator
- empiricalTreeDistributionOperator
- generalizedSkylineGibbsOperator
- gmrfBlockUpdateOperator
- gmrfFixedEffectsGibbsOperator
- jointOperator
- logRandomWalkOperator
- microsatUpDownOperator
- msatModelSelectOperator
- msatModelSwitchOperator
- mvouOperator
- narrowExchange
- newARGEvent
- nodeReHeight
- normalGammaPrecisionGibbsOperator
- normalNormalMeanGibbsOperator
- poolSwapOperator
- precisionGibbsOperator
- randomWalkIntegerNodeHeightWeightedOperator
- randomWalkIntegerOperator
- randomWalkIntegerSetSizeWeightedOperator
- randomWalkOnMapOperator
- randomWalkOperator
- rateBitExchangeOperator
- rateExchange
- rateSampleOperator
- rateScaleOperator
- rateVarianceScaleOperator
- regressionGibbsEffectOperator
- regressionGibbsPrecisionOperator
- regressionMetropolizedIndicatorOperator
- sampleNonActiveOperator
- scaleOperator
- selectorOperator
- setOperator
- slidingPatternsOperator
- subtreeSlide
- swapOperator
- teamOperator
- tipStateSwapOperator
- tipTraitSwapOperator
- traitGibbsOperator
- traitRateGibbsOperator
- treeBitMoveOperator
- treeBitRandomWalk
- treeUniform
- uniformIntegerOperator
- uniformOperator
- upDownOperator
- wideExchange
- wilsonBalding
MapDiffusionModel
Elements of this type include:
MatrixParameter
Elements of this type include:
Microsatellite
Elements of this type include:
MicrosatelliteModel
Elements of this type include:
MicrosatelliteSamplerTreeModel
Elements of this type include:
Model
Elements of this type include:
- ACLikelihood
- ASYMQUADModel
- BrownianMotion
- CovarionHKYModel
- DirichletSiteModel
- HKYModel
- LINEARBIASModel
- MutationDeathModel
- Ornstein-Uhlenbeck
- TN93Model
- TWOPHASEModel
- UCLikelihood
- alsTreeLikelihood
- aminoAcidModel
- ancestralTreeLikelihood
- anyTipObservationProcess
- arbitraryBranchRates
- argCoalescentLikelihood
- argDiscretizedBranchRates
- argLocalClock
- argRatePrior
- argTreeModel
- argUniformPrior
- betaSplittingModel
- binaryCovarionModel
- binarySubstitutionModel
- birthDeathModel
- branchingLikelihood
- cartogramDiffusionModel
- cataclysm
- categorySiteModel
- coalescentLikelihood
- compoundBranchRateModel
- constExpConst
- constantExponential
- constantLogistic
- constantSize
- continuousTraitRateModel
- covarionModel
- ctmcScalePrior
- discreteTraitRateModel
- discretizedBranchRates
- dummyModel
- empiricalPiecewise
- empiricalTreeDistributionModel
- expConstExp
- expansion
- exponentialBranchLengthsPrior
- exponentialDistributionModel
- exponentialGrowth
- exponentialLogistic
- exponentialMarkovLikelihood
- exponentialSawtooth
- frequencyModel
- gammaDistributionModel
- generalizedSkyLineLikelihood
- glmSubstitutionModel
- gmrfSkyrideLikelihood
- gmrfTestLikelihood
- greatCircleDiffusionModel
- gtrCovarionModel
- gtrModel
- hierarchicalPartitionLikelihood
- hypermutantErrorModel
- inhibitionLikelihood
- inverseGaussianDistributionModel
- lewisMk
- localClockModel
- logNormalDistributionModel
- logisticGrowth
- microsatelliteSamplerTreeLikelihood
- microsatelliteSamplerTreeModel
- mixtureCartogramDiffusionModel
- mixtureModel
- mixtureModelBranchRates
- mkSubstitutionModel
- msatAvgSubsetModel
- multivariateDiffusionModel
- multivariateOUModel
- multivariateTDiffusionModel
- multivariateTraitLikelihood
- normalDistributionModel
- onePGammaDistributionModel
- ovariableSkyLineLikelihood
- piecewisePopulation
- poissonPartitionLikelihood
- positiveDefiniteSubstitutionModel
- randomDiscretizedBranchRates
- randomLocalClockModel
- randomLocalYuleModel
- randomWalk
- rateEpochBranchRates
- sampleStateAndCategoryModel
- sampleStateModel
- scaledPiecewisePopulation
- scaledTreeLengthModel
- sequenceErrorModel
- singleTipObservationProcess
- siteModel
- speciationLikelihood
- species
- speciesTree
- strictClockBranchRates
- substitutionEpochModel
- tkf91Likelihood
- tkf91Model
- treeLikelihood
- treeModel
- twoEpoch
- uniformDistributionModel
- uniformNodeHeightPrior
- uniformPartitionLikelihood
- variableDemographic
- yangCodonModel
- yuleModel
MultivariateDiffusionModel
Elements of this type include:
MultivariateDistributionLikelihood
Elements of this type include:
MutationDeathType
Elements of this type include:
NodePosteriorTreeLikelihood
Elements of this type include:
OldAbstractCoalescentLikelihood
Elements of this type include:
OnePhaseModel
Elements of this type include:
OperatorSchedule
Elements of this type include:
Parameter
Elements of this type include:
ParametricDistributionModel
Elements of this type include:
PatternList
Elements of this type include:
Patterns
Elements of this type include:
Polygon2D
Elements of this type include:
RandomLocalTreeVariable
Elements of this type include:
RateEvolutionLikelihood
Elements of this type include:
SampledMultivariateTraitLikelihood
Elements of this type include:
Scalable
Elements of this type include:
Sequence
Elements of this type include:
SimpleMCMCOperator
Elements of this type include:
- ARGEventOperator
- FixedNodeheightSubtreePruneRegraft
- ImportanceNarrowExchange
- ImportancePruneAndRegraft
- ImportanceSubtreeSwap
- NearestNeighborInterchange
- addremoveARGEvent
- alignmentChunkOperator
- argNarrowExchange
- argPartitionOperator
- argSubtreeSlide
- argSwapOperator
- argWideExchange
- bitFlipOperator
- bitMoveOperator
- bitSwapOperator
- centeredScale
- dirtyLikelihood
- empiricalTreeDistributionOperator
- generalizedSkylineGibbsOperator
- gmrfFixedEffectsGibbsOperator
- jointOperator
- logRandomWalkOperator
- microsatUpDownOperator
- mvouOperator
- narrowExchange
- newARGEvent
- nodeReHeight
- poolSwapOperator
- randomWalkIntegerNodeHeightWeightedOperator
- randomWalkIntegerOperator
- randomWalkIntegerSetSizeWeightedOperator
- rateExchange
- rateSampleOperator
- rateScaleOperator
- rateVarianceScaleOperator
- sampleNonActiveOperator
- scaleOperator
- selectorOperator
- setOperator
- subtreeSlide
- swapOperator
- teamOperator
- tipStateSwapOperator
- tipTraitSwapOperator
- treeUniform
- uniformIntegerOperator
- uniformOperator
- upDownOperator
- wideExchange
- wilsonBalding
SimpleNode
Elements of this type include:
SiteList
Elements of this type include:
SiteModel
Elements of this type include:
SitePatterns
Elements of this type include:
SpeciationModel
Elements of this type include:
SpeciesBindings
Elements of this type include:
SpeciesBindings$SPinfo
Elements of this type include:
SpeciesTreeModel
Elements of this type include:
Statistic
Elements of this type include:
- RPNcalculator
- argReassortmentNodeCount
- argTimingStatistic
- argTotalLengthStatistic
- argTreeCount
- coalescentIntervalStatistic
- compatibilityStatistic
- compoundParameter
- compoundSymmetricMatrix
- correlation
- designMatrix
- diagonalMatrix
- differenceStatistic
- duplicatedParameter
- exponentialStatistic
- expressionStatistic
- externalLengthStatistic
- generalizedSkylinePopSizeStatistic
- gmrfHeightsStatistic
- gmrfPopSizeStatistic
- lineageCountStatistic
- logarithmStatistic
- loggableStatistic
- maskedParameter
- matrixParameter
- meanStatistic
- monophylyStatistic
- monotonicStatistic
- mrcaTraitStatistic
- multivariateOUModel
- negativeStatistic
- nodeHeightsStatistic
- notStatistic
- parameter
- parsimonyStateStatistic
- parsimonyStatistic
- partitionStatistic
- popGraph
- productStatistic
- rateCovarianceStatistic
- rateStatistic
- ratioStatistic
- reciprocalStatistic
- speciesTreeStatistic
- statistic
- subStatistic
- sumStatistic
- test
- tmrcaStatistic
- treeLengthStatistic
- treeMetricStatistic
- treeShapeStatistics
- varianceStatistic
StatisticList
Elements of this type include:
- ACLikelihood
- ASYMQUADModel
- BrownianMotion
- CovarionHKYModel
- DirichletSiteModel
- HKYModel
- LINEARBIASModel
- MutationDeathModel
- Ornstein-Uhlenbeck
- TN93Model
- TWOPHASEModel
- UCLikelihood
- alsTreeLikelihood
- aminoAcidModel
- ancestralTreeLikelihood
- anyTipObservationProcess
- arbitraryBranchRates
- argCoalescentLikelihood
- argDiscretizedBranchRates
- argLocalClock
- argRatePrior
- argTreeModel
- argUniformPrior
- betaSplittingModel
- binaryCovarionModel
- binarySubstitutionModel
- birthDeathModel
- branchingLikelihood
- cartogramDiffusionModel
- cataclysm
- categorySiteModel
- coalescentLikelihood
- compoundBranchRateModel
- constExpConst
- constantExponential
- constantLogistic
- constantSize
- continuousTraitRateModel
- covarionModel
- ctmcScalePrior
- discreteTraitRateModel
- discretizedBranchRates
- dummyModel
- empiricalPiecewise
- empiricalTreeDistributionModel
- expConstExp
- expansion
- exponentialBranchLengthsPrior
- exponentialDistributionModel
- exponentialGrowth
- exponentialLogistic
- exponentialMarkovLikelihood
- exponentialSawtooth
- frequencyModel
- gammaDistributionModel
- generalizedSkyLineLikelihood
- gmrfSkyrideLikelihood
- gmrfTestLikelihood
- greatCircleDiffusionModel
- gtrCovarionModel
- hierarchicalPartitionLikelihood
- hypermutantErrorModel
- inhibitionLikelihood
- inverseGaussianDistributionModel
- lewisMk
- localClockModel
- logNormalDistributionModel
- logisticGrowth
- microsatelliteSamplerTreeLikelihood
- microsatelliteSamplerTreeModel
- mixtureCartogramDiffusionModel
- mixtureModelBranchRates
- mkSubstitutionModel
- msatAvgSubsetModel
- multivariateDiffusionModel
- multivariateOUModel
- multivariateTDiffusionModel
- multivariateTraitLikelihood
- normalDistributionModel
- onePGammaDistributionModel
- ovariableSkyLineLikelihood
- piecewisePopulation
- poissonPartitionLikelihood
- positiveDefiniteSubstitutionModel
- randomDiscretizedBranchRates
- randomLocalClockModel
- randomLocalYuleModel
- randomWalk
- rateEpochBranchRates
- sampleStateAndCategoryModel
- sampleStateModel
- scaledPiecewisePopulation
- scaledTreeLengthModel
- sequenceErrorModel
- singleTipObservationProcess
- siteModel
- speciationLikelihood
- species
- speciesTree
- strictClockBranchRates
- substitutionEpochModel
- tkf91Likelihood
- tkf91Model
- treeLikelihood
- treeModel
- twoEpoch
- uniformDistributionModel
- uniformNodeHeightPrior
- uniformPartitionLikelihood
- variableDemographic
- yangCodonModel
- yuleModel
String
Elements of this type include:
String;
Elements of this type include:
SubstitutionModel
Elements of this type include:
- ASYMQUADModel
- CovarionHKYModel
- HKYModel
- LINEARBIASModel
- MutationDeathModel
- TN93Model
- TWOPHASEModel
- aminoAcidModel
- binaryCovarionModel
- binarySubstitutionModel
- covarionModel
- glmSubstitutionModel
- gtrCovarionModel
- gtrModel
- lewisMk
- mkSubstitutionModel
- msatAvgSubsetModel
- positiveDefiniteSubstitutionModel
- substitutionEpochModel
- yangCodonModel
TKF91Likelihood
Elements of this type include:
TKF91Model
Elements of this type include:
TabularData
Elements of this type include:
Taxa
Elements of this type include:
Taxon
Elements of this type include:
TaxonList
Elements of this type include:
- alignment
- argTreeModel
- ascertainedPatterns
- attributePatterns
- convert
- distanceMatrix
- empiricalTreeDistributionModel
- hypermutantAlignment
- mergePatterns
- microsatellitePattern
- microsatelliteSimulator
- neighborJoiningTree
- newick
- patternSubSet
- patterns
- sequenceSimulator
- speciesTree
- taxa
- tree
- treeModel
- upgmaTree
TipPartialsModel
Elements of this type include:
Tree
Elements of this type include:
TreeAttributeProvider
Elements of this type include:
TreeColouringProvider
Elements of this type include:
TreeLikelihood
Elements of this type include:
TreeLogger$LogUpon
Elements of this type include:
TreeModel
Elements of this type include:
TreeTraitProvider
Elements of this type include:
ValuesPool
Elements of this type include:
Variable
Elements of this type include:
VariableDemographicModel
Elements of this type include:

