BEAST v1.6.x XML Reference

From BEAST Software

Jump to: navigation, search

BEAST Documentation-> BEAST v1.6.x XML Reference

Contents

BEAST v1.6.0 Parser Library (2002-2010)

Release Version (updated on 17 September 2010 NZST)

The following is a list of valid elements in a beast file.

<ACLikelihood> element

This element returns an object that can calculate the likelihood of rate changes in a tree under the assumption of distributed rate changes among lineages. Specifically, each branch is assumed to draw a rate from a distribution with mean of the rate in the parent branch and the given standard deviation (the variance can be optionally proportional to branch length).


The element takes following attributes:

  • Attribute episodic is Boolean
    true if model is branch length independent, false if length-dependent.
  • Attribute distribution is String
    The distribution to use


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The branch rates parameter
  • Element named <rootRate> containing:
    • Parameter element (exactly one)
      The root rate parameter
  • Element named <variance> containing:
    • Parameter element (exactly one)
      The standard deviation of the distribution


Example:

<ACLikelihood episodic="true" distribution="foo">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel4"/>
 <rates>
   <matrixParameter idref="matrixParameter4"/>
 </rates>
 <rootRate>
   <maskedParameter idref="maskedParameter10"/>
 </rootRate>
 <variance>
   <matrixParameter idref="matrixParameter5"/>
 </variance>
</ACLikelihood>


<addremoveARGEvent> element

An operator that slides a subarg.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute size is Double
  • Attribute gaussian is Boolean
  • Attribute (optional) swapRates is Boolean
  • Attribute (optional) swapTraits is Boolean
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<addremoveARGEvent weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
  <argTreeModel idref="argTreeModel9"/>
</addremoveARGEvent>


<alignment> element

This element represents an alignment of molecular sequences.


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The data type
    • DataType element (exactly one)


Example:

<!-- An alignment of three short DNA sequences -->
<alignment missing="-?" dataType="nucleotide">
  <sequence>
    <taxon idref="taxon1"/>
    ACGACTAGCATCGAGCTTCG--GATAGCAGGC
  </sequence>
  <sequence>
    <taxon idref="taxon2"/>
    ACGACTAGCATCGAGCTTCGG-GATAGCATGC
  </sequence>
  <sequence>
    <taxon idref="taxon3"/>
    ACG?CTAGAATCGAGCTTCGAGGATAGCATGC
  </sequence>
</alignment>


<alignmentChunkOperator> element

This element represents an operator that re-aligns a small chunk of an alignment.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute iP is Double
    tuning probability, values near zero resamples entire alignment and near 1.0 resamples single columns.
  • Attribute exponent is Double
    tuning parameter, value of 1.0 samples random alignments, large values (e.g. 2.7) sample alignment peaked around 'best' alignment
  • Attribute gapPenalty is Double
    tuning parameter, must be negative, large values penalize gaps more in the alignment proposal.


The element has the following contents:


Example:

<alignmentChunkOperator weight="1.0" iP="1.0" exponent="1.0" gapPenalty="1.0">
  <tkf91Likelihood idref="tkf91Likelihood2"/>
</alignmentChunkOperator>


<alsTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) storePartials is Boolean
  • Attribute integrateGainRate is Boolean


The element has the following contents:


Example:

<alsTreeLikelihood useAmbiguities="true" storePartials="true" integrateGainRate="true">
  <convert idref="convert1"/>
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel9"/>
  <categorySiteModel idref="categorySiteModel5"/>
 <observationProcess type="foo" taxon="foo"/>
</alsTreeLikelihood>


<aminoAcidModel> element

An empirical amino acid substitution model.


The element takes following attributes:

  • Attribute type is String
    The type of empirical amino-acid rate matrix


The element has the following contents:

  • Element named <frequencies> containing:
    • FrequencyModel element (exactly one)
      If the frequencies are omitted than the empirical frequencies associated with the selected model are used.


Example:

<aminoAcidModel type="WAG"/>


<ancestralTrait> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging
  • Attribute (optional) traitName is String
    The name of the trait to log


The element has the following contents:


Example:

<ancestralTrait name="foo" traitName="foo">
  <treeModel idref="treeModel3"/>
  <multivariateTraitLikelihood idref="multivariateTraitLikelihood1"/>
 <mrca>
   <taxa idref="taxa10"/>
 </mrca>
</ancestralTrait>


<ancestralTrait> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging
  • Attribute (optional) traitName is String
    The name of the trait to log


The element has the following contents:


Example:

<ancestralTrait name="foo" traitName="foo">
  <treeModel idref="treeModel6"/>
  <ancestralTreeLikelihood idref="ancestralTreeLikelihood5"/>
 <mrca>
   <taxa idref="taxa1"/>
 </mrca>
</ancestralTrait>


<ancestralTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) storePartials is Boolean
  • Attribute (optional) tagName is String
  • Attribute (optional) forceRescaling is Boolean
  • Attribute (optional) useMAP is Boolean
  • Attribute (optional) useMarginalLikelihood is Boolean


The element has the following contents:


Example:

<ancestralTreeLikelihood useAmbiguities="true" storePartials="true" tagName="foo" forceRescaling="true" useMAP="true" useMarginalLikelihood="true">
  <convert idref="convert5"/>
  <treeModel idref="treeModel10"/>
  <sampleStateAndCategoryModel idref="sampleStateAndCategoryModel6"/>
  <TWOPHASEModel idref="TWOPHASEModel2"/>
</ancestralTreeLikelihood>


<anyTipObservationProcess> element

This element represents an instance of the AnyTipObservationProcess for ALSTreeLikelihood calculations


The element has the following contents:


Example:

<anyTipObservationProcess>
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3"/>
  <patterns idref="patterns1"/>
  <sampleStateAndCategoryModel idref="sampleStateAndCategoryModel3"/>
  <scaledTreeLengthModel idref="scaledTreeLengthModel1"/>
 <deathRate>
   <duplicatedParameter idref="duplicatedParameter6"/>
 </deathRate>
 <immigrationRate>
   <matrixParameter idref="matrixParameter3"/>
 </immigrationRate>
</anyTipObservationProcess>


<arbitraryBranchRates> element

This element returns an arbitrary rate model.The branch rates are drawn from an arbitrary distribution determine by the prior.


The element takes following attributes:

  • Attribute (optional) reciprocal is Boolean


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The rate parameter


Example:

<arbitraryBranchRates reciprocal="true">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2"/>
 <rates>
   <designMatrix idref="designMatrix1"/>
 </rates>
</arbitraryBranchRates>


<argCoalescentLikelihood> element

A coalescent likelihood for an ARG model


The element takes following attributes:

  • Attribute (optional) ancestralRestriction is Boolean


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <recombinationRate> containing:
  • Element named <argModel> containing:


Example:

<argCoalescentLikelihood ancestralRestriction="true">
 <populationSize>
   <diagonalMatrix idref="diagonalMatrix9"/>
 </populationSize>
 <recombinationRate>
   <compoundParameter idref="compoundParameter7"/>
 </recombinationRate>
 <argModel>
   <argTreeModel idref="argTreeModel3"/>
 </argModel>
</argCoalescentLikelihood>


<argDiscretizedBranchRates> element

This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.


The element takes following attributes:

  • Attribute numRateCategories is Integer


The element has the following contents:


Example:

<argDiscretizedBranchRates numRateCategories="1">
  <argTreeModel idref="argTreeModel6"/>
 <distribution>
   <onePGammaDistributionModel idref="onePGammaDistributionModel3"/>
 </distribution>
</argDiscretizedBranchRates>


<ARGEventOperator> element

An operator that slides a subarg.


The element takes following attributes:

  • Attribute addProbability is Double
    The probability that the operator adds a new reassortment event
  • Attribute (optional) jointPartitioning is Boolean
  • Attribute (optional) tossSize is Integer
  • Attribute (optional) addProbability is Double
  • Attribute (optional) autoOptimize is Boolean
  • Attribute weight is Integer


The element has the following contents:


Example:

<ARGEventOperator addProbability="1.0" jointPartitioning="true" tossSize="1" addProbability="1.0" autoOptimize="true" weight="1">
  <argTreeModel idref="argTreeModel1"/>
  <poissonPartitionLikelihood idref="poissonPartitionLikelihood6"/>
 <internalNodes>
   <matrixParameter idref="matrixParameter7"/>
 </internalNodes>
 <internalNodesPlusRoot>
   <matrixParameter idref="matrixParameter9"/>
 </internalNodesPlusRoot>
 <nodeRates>
   <diagonalMatrix idref="diagonalMatrix10"/>
 </nodeRates>
</ARGEventOperator>


<argLocalClock> element

null


Example:

<argLocalClock/>


<argTreeModel> element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.


The element takes following attributes:

  • Attribute (optional) partitionType is String
    Describes the partition structure of the model


The element has the following contents:

  • Tree element (exactly one)
  • Element named <rootHeight> containing:
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)
  • Element named <nodeHeights> containing:
    • Attribute (optional) rootNode is Boolean
      If true the root height is included in the parameter
    • Attribute (optional) internalNodes is Boolean
      If true the internal node heights (minus the root) are included in the parameter
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)


Example:

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>


<argNarrowExchange> element

This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.


The element takes following attributes:


The element has the following contents:


Example:

<argNarrowExchange weight="1">
  <argTreeModel idref="argTreeModel3"/>
</argNarrowExchange>


<argPartitionOperator> element

An operator that picks a new partitioning uniformly at random.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute (optional) tossSize is Integer
  • Attribute (optional) tossAll is Boolean


The element has the following contents:


Example:

<argPartitionOperator weight="1" tossSize="1" tossAll="true">
  <argTreeModel idref="argTreeModel8"/>
</argPartitionOperator>


<argRatePrior> element

null


Example:

<argRatePrior/>


<argReassortmentNodeCount> element

A statistic that returns the number of reassortment nodes in an ARG


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic for the purpose of logging


The element has the following contents:


Example:

<argReassortmentNodeCount name="foo">
  <argTreeModel idref="argTreeModel8"/>
</argReassortmentNodeCount>


<argSubtreeSlide> element

An operator that slides a subtree.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute size is Double
  • Attribute gaussian is Boolean
  • Attribute (optional) swapRates is Boolean
  • Attribute (optional) swapTraits is Boolean
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<argSubtreeSlide weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
  <argTreeModel idref="argTreeModel9"/>
</argSubtreeSlide>


<argSwapOperator> element

Swaps nodes on a tree


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute type is String
    The mode of the operator


The element has the following contents:


Example:

<argSwapOperator weight="1" type="bifurcationSwap">
  <argTreeModel idref="argTreeModel1"/>
</argSwapOperator>


<argTimingStatistic> element

The element takes following attributes:

  • Attribute (optional) name is String


The element has the following contents:


Example:

<argTimingStatistic name="foo">
  <argTreeModel idref="argTreeModel9"/>
</argTimingStatistic>


<argTotalLengthStatistic> element

null


Example:

<argTotalLengthStatistic/>


<argTraceAnalysis> element

Analyses and reports on a trace consisting of trees.


The element takes following attributes:

  • Attribute fileName is String
    name of a tree log file
  • Attribute (optional) burnIn is Integer


Example:

<argTraceAnalysis fileName="trees.log" burnIn="1"/>


<argTreeCount> element

Provides number of distinct loci trees


The element has the following contents:


Example:

<argTreeCount>
  <argTreeModel idref="argTreeModel9"/>
</argTreeCount>


<argTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) storePartials is Boolean
  • Attribute (optional) useScaling is Boolean


The element has the following contents:


Example:

<argTreeLikelihood useAmbiguities="true" storePartials="true" useScaling="true">
  <convert idref="convert3"/>
  <argTreeModel idref="argTreeModel2"/>
  <categorySiteModel idref="categorySiteModel7"/>
</argTreeLikelihood>


<argTreeModel> element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.


The element takes following attributes:

  • Attribute (optional) partitionType is String
    Describes the partition structure of the model


The element has the following contents:

  • Tree element (exactly one)
  • Element named <rootHeight> containing:
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)
  • Element named <nodeHeights> containing:
    • Attribute (optional) rootNode is Boolean
      If true the root height is included in the parameter
    • Attribute (optional) internalNodes is Boolean
      If true the internal node heights (minus the root) are included in the parameter
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)


Example:

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>


<argUniformPrior> element

A uniform prior for an ARG model


The element has the following contents:


Example:

<argUniformPrior>
  <argTreeModel idref="argTreeModel5"/>
</argUniformPrior>


<argWideExchange> element

This element represents a wide exchange operator. This operator swaps two random subtrees.


The element takes following attributes:


The element has the following contents:


Example:

<argWideExchange weight="1">
  <argTreeModel idref="argTreeModel1"/>
</argWideExchange>


<array> element

This element returns an array of the objects it contains.


The element has the following contents:

  • Object elements (one or more)
    Objects to be put in an array


Example:

<array>
  <treeTraceAnalysis idref="treeTraceAnalysis8"/>
  <normalDistributionModel idref="normalDistributionModel6"/>
  <operators idref="operators4"/>
</array>


<ascertainedPatterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.


The element takes following attributes:

  • Attribute (optional) from is Integer
    The site position to start at, default is 1 (the first position)
  • Attribute (optional) to is Integer
    The site position to finish at, must be greater than from, default is length of given alignment
  • Attribute (optional) every is Integer
    Determines how many sites are selected. A value of 3 will select every third site starting from from, default is 1 (every site)


The element has the following contents:

  • Element named <taxonList> containing:
  • Alignment element (exactly one)
    <includePatterns from="Z" to="X"/>*:<excludePatterns from="Z" to="X"/>

Example:

<ascertainedPatterns from="1" to="1" every="1">
  <hypermutantAlignment idref="hypermutantAlignment8"/>
</ascertainedPatterns>


<ASYMQUADModel> element

This element represents an instance of the stepwise mutation model of microsatellite evolution.


The element takes following attributes:

  • Attribute (optional) isSubmodel is Boolean


The element has the following contents:

  • Microsatellite element (exactly one)
  • FrequencyModel element (zero or one)
  • Element named <ExpansionConstant> containing:
  • Element named <ContractionConstant> containing:
  • Element named <ExpansionLinear> containing:
  • Element named <ContractionLinear> containing:
  • Element named <ExpansionQuad> containing:
  • Element named <ContractionQuad> containing:


Example:

<ASYMQUADModel isSubmodel="true">
  <microsatellite idref="microsatellite3"/>
</ASYMQUADModel>


<attr> element

This element represents a name/value pair.


The element takes following attributes:

  • Attribute name is String
    The name to give to this attribute


The element has the following contents:


Example:

<attr name="foo">
  <hypermutantErrorModel idref="hypermutantErrorModel6"/>
</attr>


<attributePatterns> element

A site pattern defined by an attribute in a set of taxa.


The element takes following attributes:

  • Attribute attribute is String


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The data type
    • DataType element (exactly one)
  • TaxonList element (exactly one)
    The taxon set


Example:

<attributePatterns attribute="foo">
  <extendedDataType idref="extendedDataType10"/>
  <attributePatterns idref="attributePatterns1"/>
</attributePatterns>


<attributes> element

This element represents an array of name/value pairs.


The element takes following attributes:


Example:

<attributes names="foo bar" values="foo bar"/>


<avgPosteriorIBDReporter> element

This element represents a reporter for average expected number of tips ibd conditional on observed patterns.


The element has the following contents:


Example:

<avgPosteriorIBDReporter>
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/>
  <LINEARBIASModel idref="LINEARBIASModel8"/>
  <maskedParameter idref="maskedParameter6"/>
  ERROR!
</avgPosteriorIBDReporter>


<ancestralTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) storePartials is Boolean
  • Attribute (optional) tagName is String
  • Attribute (optional) forceRescaling is Boolean
  • Attribute (optional) useMAP is Boolean
  • Attribute (optional) useMarginalLikelihood is Boolean


The element has the following contents:


Example:

<ancestralTreeLikelihood useAmbiguities="true" storePartials="true" tagName="foo" forceRescaling="true" useMAP="true" useMarginalLikelihood="true">
  <ascertainedPatterns idref="ascertainedPatterns8"/>
  <treeModel idref="treeModel6"/>
  <siteModel idref="siteModel7"/>
  <MutationDeathModel idref="MutationDeathModel8"/>
</ancestralTreeLikelihood>


<complexSubstitutionModel> element

A general reversible model of sequence substitution for any data type with stochastic variable selection.


The element takes following attributes:

  • Attribute (optional) randomizeIndicator is Boolean
  • Attribute (optional) normalize is Boolean
  • Attribute (optional) maxConditionNumber is Double
  • Attribute (optional) mustBeConnected is Boolean
  • Attribute (optional) maxIterations is Integer
  • Attribute (optional) checkConditioning is Boolean


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <rootFrequencies> containing:
  • Element named <rates> containing:
  • Element named <rateIndicator> containing:


Example:

<complexSubstitutionModel dataType="amino acid" randomizeIndicator="true" normalize="true" maxConditionNumber="1.0" mustBeConnected="true" maxIterations="1" checkConditioning="true">
 <rootFrequencies>
   <frequencyModel idref="frequencyModel1"/>
 </rootFrequencies>
 <rates>
   <matrixParameter idref="matrixParameter9"/>
 </rates>
</complexSubstitutionModel>


<DirichletSiteModel> element

A SiteModel that has Dirichlet distributed rates across sites


The element has the following contents:

  • Element named <substitutionModel> containing:
  • Element named <rates> containing:


Example:

<DirichletSiteModel>
 <substitutionModel>
   <mkSubstitutionModel idref="mkSubstitutionModel10"/>
 </substitutionModel>
 <rates>
   <duplicatedParameter idref="duplicatedParameter7"/>
 </rates>
</DirichletSiteModel>


<frequencyModel> element

A model of equilibrium base frequencies.


The element takes following attributes:

  • Attribute (optional) normalize is Boolean


The element has the following contents:

  • PatternList element (zero or one)
    Initial value
  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <frequencies> containing:


Example:

<frequencyModel normalize="true" dataType="codon-yeast">
 <frequencies>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/>
 </frequencies>
</frequencyModel>


<siteModel> element

A SiteModel that has a gamma distributed rates across sites


The element has the following contents:

  • Element named <substitutionModel> containing:
  • One of:
    • Element named <mutationRate> containing:
    • Element named <relativeRate> containing:
  • Element named <gammaShape> containing:
    • Attribute (optional) gammaCategories is Integer
    • Parameter element (exactly one)
  • Element named <proportionInvariant> containing:


Example:

<siteModel>
 <substitutionModel>
   <LINEARBIASModel idref="LINEARBIASModel6"/>
 </substitutionModel>
 <mutationRate>
   <parameter idref="parameter4"/>
 </mutationRate>
</siteModel>


<benchmarker> element

This element runs a benchmark on a series of likelihood calculators.


The element takes following attributes:

  • Attribute iterationCount is Integer


The element has the following contents:


Example:

<benchmarker iterationCount="1">
  <discretizedBranchRates idref="discretizedBranchRates9"/>
</benchmarker>


<betaSplittingModel> element

The beta-splitting family of tree branching models (Aldous, 1996;2001).


The element has the following contents:

  • Element named <phi> containing:
    • Parameter element (exactly one)
      A parameter that ranges from -infinity (comb-tree) to +infinity (balanced tree)
  • Element named <branchingTree> containing:
    • Tree element (exactly one)


Example:

<betaSplittingModel>
 <phi>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix4"/>
 </phi>
 <branchingTree>
   <speciesTree idref="speciesTree9"/>
 </branchingTree>
</betaSplittingModel>


<binaryCovarionModel> element

A covarion substitution model on binary data and a hidden rate state with two rates.


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <hiddenFrequencies> containing:
  • Element named <alpha> containing:
  • Element named <switchingRate> containing:


Example:

<binaryCovarionModel>
 <frequencies>
   <maskedParameter idref="maskedParameter3"/>
 </frequencies>
 <hiddenFrequencies>
   <duplicatedParameter idref="duplicatedParameter5"/>
 </hiddenFrequencies>
 <alpha/>
 <switchingRate/>
</binaryCovarionModel>


<binarySubstitutionModel> element

A general reversible model of sequence substitution for binary data type.


The element has the following contents:

  • Element named <frequencies> containing:


Example:

<binarySubstitutionModel>
 <frequencies>
   <frequencyModel idref="frequencyModel9"/>
 </frequencies>
</binarySubstitutionModel>


<binomialLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.


The element has the following contents:

  • Element named <trials> containing:
  • Element named <proportion> containing:
  • Element named <counts> containing:


Example:

<binomialLikelihood>
 <trials>
   <parameter idref="parameter3"/>
 </trials>
 <proportion>
   <maskedParameter idref="maskedParameter2"/>
 </proportion>
 <counts values="1 2 4 8"/>
</binomialLikelihood>


<birthDeathModel> element

Gernhard (2008) model of speciation (equation at bottom of page 19 of draft).


The element takes following attributes:

  • Attribute (optional) type is String
  • Attribute (optional) conditionalOnRoot is Boolean
  • Attribute units is String
    the units


The element has the following contents:

  • Element named <birthMinusDeathRate> containing:
  • Element named <relativeDeathRate> containing:
  • Element named <sampleRate> containing:


Example:

<birthDeathModel type="foo" conditionalOnRoot="true" units="years">
 <birthMinusDeathRate>
   <diagonalMatrix idref="diagonalMatrix5"/>
 </birthMinusDeathRate>
 <relativeDeathRate>
   <maskedParameter idref="maskedParameter4"/>
 </relativeDeathRate>
</birthDeathModel>


<bitFlipInSubstitutionModelOperator> element

This element returns a bit-flip operator on a given indicatorParameter.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute scaleFactor is Double
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<bitFlipInSubstitutionModelOperator weight="1.0" scaleFactor="1.0" autoOptimize="true">
  ERROR!
</bitFlipInSubstitutionModelOperator>


<bitFlipOperator> element

This element returns a bit-flip operator on a given parameter.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) usesPriorOnSum is Boolean


The element has the following contents:


Example:

<bitFlipOperator weight="1.0" usesPriorOnSum="true">
  <diagonalMatrix idref="diagonalMatrix4"/>
</bitFlipOperator>


<bitMoveOperator> element

This element returns a bit-move operator on a given parameter.


The element takes following attributes:


The element has the following contents:

  • Element named <bits> containing:
  • Element named <values> containing:
    • Parameter element (exactly one)
      values parameter


Example:

<bitMoveOperator weight="1.0" numBitsToMove="1">
 <bits>
   <parameter idref="parameter1"/>
 </bits>
</bitMoveOperator>


<bitSwapOperator> element

This element returns a bit-swap operator on a given parameter and data.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) radius is Double


The element has the following contents:

  • Element named <data> containing:
  • Element named <indicators> containing:


Example:

<bitSwapOperator weight="1.0" radius="1.0">
 <data>
   <partitionStatistic idref="partitionStatistic9"/>
 </data>
 <indicators>
   <treeLengthStatistic idref="treeLengthStatistic5"/>
 </indicators>
</bitSwapOperator>


<booleanLikelihood> element

A function that log likelihood of a set of boolean statistics. If all the statistics are true then it returns 0.0 otherwise -infinity.


The element has the following contents:


Example:

<booleanLikelihood>
  <compatibilityStatistic idref="compatibilityStatistic5"/>
  <compatibilityStatistic idref="compatibilityStatistic2"/>
  <monotonicStatistic idref="monotonicStatistic3"/>
  <compatibilityStatistic idref="compatibilityStatistic5"/>
</booleanLikelihood>


<branchDirections> element

null


The element has the following contents:


Example:

<branchDirections>
  ERROR!
</branchDirections>


<branchingLikelihood> element

This element represents the likelihood of the tree given the demographic function.


The element has the following contents:

  • Element named <model> containing:
  • Element named <branchingTree> containing:


Example:

<branchingLikelihood>
 <model>
   <betaSplittingModel idref="betaSplittingModel3"/>
 </model>
 <branchingTree>
   <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/>
 </branchingTree>
</branchingLikelihood>


<branchMagnitudes> element

null


The element takes following attributes:

  • Attribute (optional) scaleByLength is Boolean


The element has the following contents:


Example:

<branchMagnitudes scaleByLength="true">
  <inhibitionLikelihood idref="inhibitionLikelihood3"/>
</branchMagnitudes>


<BrownianMotion> element

The element takes following attributes:

  • Attribute (optional) logUnits is Boolean


The element has the following contents:

  • One of:
    • Element named <sigma> containing:
    • Element named <sigma> containing:


Example:

<BrownianMotion logUnits="true">
 <sigma>
   1.0
 </sigma>
  <variableDemographic idref="variableDemographic7"/>
</BrownianMotion>


<cachedPrior> element

Calculates a cached likelihood of some data given some parametric or empirical distribution.


The element has the following contents:


Example:

<cachedPrior>
  <cachedPrior idref="cachedPrior6"/>
  <diagonalMatrix idref="diagonalMatrix1"/>
</cachedPrior>


<cartogramDiffusionModel> element

Describes a bivariate diffusion process using cartogram distances.


The element takes following attributes:

  • Attribute (optional) cartogramFileName is String
  • Attribute xGridSize is Integer
  • Attribute yGridSize is Integer


The element has the following contents:

  • Parameter element (exactly one)
  • Element named <boundingBox> containing:


Example:

<cartogramDiffusionModel cartogramFileName="foo" xGridSize="1" yGridSize="1">
  <designMatrix idref="designMatrix10"/>
 <boundingBox minX="1.0" maxX="1.0" minY="1.0" maxY="1.0"/>
</cartogramDiffusionModel>


<cataclysm> element

A demographic model of exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <growthRate> containing:
    • Parameter element (exactly one)
      The rate of exponential growth before the cataclysmic event.
  • Element named <spikeFactor> containing:
    • Parameter element (exactly one)
      The factor larger the population size was at its height.
  • Element named <timeOfCataclysm> containing:
    • Parameter element (exactly one)
      The time of the cataclysmic event that lead to exponential decline.


Example:

<cataclysm units="years">
 <populationSize>
   <maskedParameter idref="maskedParameter2"/>
 </populationSize>
 <growthRate>
   <compoundParameter idref="compoundParameter6"/>
 </growthRate>
 <spikeFactor>
   <diagonalMatrix idref="diagonalMatrix2"/>
 </spikeFactor>
 <timeOfCataclysm>
   <duplicatedParameter idref="duplicatedParameter4"/>
 </timeOfCataclysm>
</cataclysm>


<categorySiteModel> element

A SiteModel that has a gamma distributed rates across sites


The element has the following contents:

  • Element named <substitutionModel> containing:
  • Element named <mutationRate> containing:
  • Element named <rates> containing:
  • Element named <categories> containing:
    • Attribute (optional) values is String
    • Attribute (optional) states is String


Example:

<categorySiteModel>
 <substitutionModel>
   <positiveDefiniteSubstitutionModel idref="positiveDefiniteSubstitutionModel4"/>
 </substitutionModel>
 <mutationRate>
   <compoundParameter idref="compoundParameter8"/>
 </mutationRate>
</categorySiteModel>


<centeredScale> element

A centered-scale operator. This operator scales the the values of a multi-dimensional parameter so as to perserve the mean. It does this by expanding or conrtacting the parameter values around the mean.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute scaleFactor is Double
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<centeredScale weight="1.0" scaleFactor="1.0" autoOptimize="true">
  <duplicatedParameter idref="duplicatedParameter8"/>
</centeredScale>


<circle> element

This element represents a regular circle polygon.


The element takes following attributes:

  • Attribute latitude is Double
  • Attribute longitude is Double
  • Attribute radius is Double
  • Attribute (optional) numberOfPoints is Integer


Example:

<circle latitude="1.0" longitude="1.0" radius="1.0" numberOfPoints="1"/>


<coalescentIntervalStatistic> element

The element has the following contents:


Example:

<coalescentIntervalStatistic>
  <gmrfTestLikelihood idref="gmrfTestLikelihood4"/>
</coalescentIntervalStatistic>


<coalescentLikelihood> element

This element represents the likelihood of the tree given the demographic function.


The element has the following contents:

  • Element named <model> containing:
    • DemographicModel element (exactly one)
      The demographic model which describes the effective population size over time
  • Element named <populationTree> containing:
    • Attribute (optional) factor is Double
    • TreeModel element (exactly one)
      Tree(s) to compute likelihood for
  • Element named <include> containing:
    • Taxa element (exactly one)
      An optional subset of taxa on which to calculate the likelihood (should be monophyletic)
  • Element named <exclude> containing:
    • Taxa elements (one or more)
      One or more subsets of taxa which should be excluded from calculate the likelihood (should be monophyletic)


Example:

<coalescentLikelihood>
 <model>
   <scaledPiecewisePopulation idref="scaledPiecewisePopulation9"/>
 </model>
 <populationTree factor="1.0">
   <treeModel idref="treeModel9"/>
 </populationTree>
 <populationTree factor="1.0">
   <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2"/>
 </populationTree>
</coalescentLikelihood>


<coalescentTree> element

This element returns a simulated tree under the given demographic model.


The element takes following attributes:

  • Attribute (optional) rescaleHeight is Double
    Attempt to rescale the tree to the given root height
  • Attribute (optional) rootHeight is Double
    '


The element has the following contents:


Example:

<coalescentTree rescaleHeight="1.0" rootHeight="1.0">
  <argTreeModel idref="argTreeModel5"/>
  <speciesTree idref="speciesTree7"/>
  <upgmaTree idref="upgmaTree8"/>
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1"/>
  <patterns idref="patterns2"/>
  <alignment idref="alignment8"/>
  <newick idref="newick5"/>
  <constantExponential idref="constantExponential7"/>
</coalescentTree>


<column> element

Specifies formating options for one or more columns in a log file.


The element takes following attributes:

  • Attribute (optional) label is String
    The label of the column. If this is specified and more than one statistic is in this column, then the label will be appended by the index of the statistic to create individual column names
  • Attribute (optional) sf is Integer
  • Attribute (optional) dp is Integer
  • Attribute (optional) width is Integer
  • Attribute (optional) format is String


The element has the following contents:

  • Object elements (one or more)


Example:

<column label="foo" sf="1" dp="1" width="1" format="foo">
  <continuousTraitRateModel idref="continuousTraitRateModel3"/>
  <logML idref="logML10"/>
  <designMatrix idref="designMatrix10"/>
</column>


<compatibilityStatistic> element

A statistic that returns true if a pair of trees are compatible


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic for the purpose of logging


The element has the following contents:

  • Tree element (exactly one)
  • Element named <compatibleWith> containing:
    • Tree element (exactly one)
  • Tree element (exactly one)


Example:

<compatibilityStatistic name="foo">
  <treeModel idref="treeModel8"/>
 <compatibleWith>
   <argTreeModel idref="argTreeModel4"/>
 </compatibleWith>
  <argTreeModel idref="argTreeModel7"/>
</compatibilityStatistic>


<complexSubstitutionModel> element

A general reversible model of sequence substitution for any data type with stochastic variable selection.


The element takes following attributes:

  • Attribute (optional) randomizeIndicator is Boolean
  • Attribute (optional) normalize is Boolean
  • Attribute (optional) maxConditionNumber is Double
  • Attribute (optional) mustBeConnected is Boolean
  • Attribute (optional) maxIterations is Integer
  • Attribute (optional) checkConditioning is Boolean


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <rootFrequencies> containing:
  • Element named <rates> containing:
  • Element named <rateIndicator> containing:


Example:

<complexSubstitutionModel randomizeIndicator="true" normalize="true" maxConditionNumber="1.0" mustBeConnected="true" maxIterations="1" checkConditioning="true">
  <hiddenNucleotides idref="hiddenNucleotides2"/>
 <rootFrequencies>
   <frequencyModel idref="frequencyModel2"/>
 </rootFrequencies>
 <rates>
   <maskedParameter idref="maskedParameter10"/>
 </rates>
</complexSubstitutionModel>


<compoundBranchRateModel> element

This element provides a strict clock model. All branches have the same rate of molecular evolution.


The element has the following contents:


Example:

<compoundBranchRateModel>
  <localClockModel idref="localClockModel6"/>
  <arbitraryBranchRates idref="arbitraryBranchRates9"/>
  <argDiscretizedBranchRates idref="argDiscretizedBranchRates9"/>
</compoundBranchRateModel>


<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) threads is Integer


The element has the following contents:


Example:

<compoundLikelihood threads="1">
  <coalescentLikelihood idref="coalescentLikelihood8"/>
  <speciesTreePopulationPrior idref="speciesTreePopulationPrior3"/>
</compoundLikelihood>


<compoundParameter> element

A multidimensional parameter constructed from its component parameters.


The element has the following contents:


Example:

<compoundParameter>
  <designMatrix idref="designMatrix4"/>
</compoundParameter>


<compoundSymmetricMatrix> element

A diagonal matrix parameter constructed from its diagonals.


The element takes following attributes:

  • Attribute (optional) asCorrelation is Boolean


The element has the following contents:

  • Element named <diagonal> containing:
  • Element named <offDiagonal> containing:


Example:

<compoundSymmetricMatrix asCorrelation="true">
 <diagonal>
   <designMatrix idref="designMatrix9"/>
 </diagonal>
 <offDiagonal>
   <compoundParameter idref="compoundParameter8"/>
 </offDiagonal>
</compoundSymmetricMatrix>


<constantExponential> element

A demographic model of constant population size followed by exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <growthPhaseStartTime> containing:
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time.


Example:

<constantExponential units="generations">
 <populationSize>
   <matrixParameter idref="matrixParameter1"/>
 </populationSize>
 <growthPhaseStartTime>
   <matrixParameter idref="matrixParameter7"/>
 </growthPhaseStartTime>
 <doublingTime>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix3"/>
 </doublingTime>
</constantExponential>


<constantLogistic> element

A demographic model of constant population size followed by logistic growth.


The element takes following attributes:

  • Attribute units is String
    the units
  • Attribute alpha is Double


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <ancestralPopulationSize> containing:
  • Element named <growthRate> containing:
  • Element named <shape> containing:


Example:

<constantLogistic units="substitutions" alpha="1.0">
 <populationSize>
   <diagonalMatrix idref="diagonalMatrix10"/>
 </populationSize>
 <ancestralPopulationSize>
   <maskedParameter idref="maskedParameter4"/>
 </ancestralPopulationSize>
 <growthRate>
   <designMatrix idref="designMatrix6"/>
 </growthRate>
 <shape>
   <designMatrix idref="designMatrix6"/>
 </shape>
</constantLogistic>


<constantSize> element

A demographic model representing a constant population size through time.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:


Example:

<constantSize units="years">
 <populationSize>
   <diagonalMatrix idref="diagonalMatrix1"/>
 </populationSize>
</constantSize>


<constExpConst> element

A demographic model of constant population size followed by exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <ancestralPopulationSize> containing:
  • Element named <finalPhaseStartTime> containing:
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time.


Example:

<constExpConst units="days">
 <populationSize>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix4"/>
 </populationSize>
 <ancestralPopulationSize>
   <parameter idref="parameter10"/>
 </ancestralPopulationSize>
 <finalPhaseStartTime>
   <compoundParameter idref="compoundParameter3"/>
 </finalPhaseStartTime>
 <doublingTime>
   <maskedParameter idref="maskedParameter9"/>
 </doublingTime>
</constExpConst>


<continuousTraitRateModel> element

This element returns an trait rate model.The branch rates are an average of the rates provided by a node trait.


The element takes following attributes:

  • Attribute (optional) dimension is Integer
    The dimension that supplies the rate


The element has the following contents:


Example:

<continuousTraitRateModel dimension="1"/>


<convert> element

Converts an alignment to the given data type.


The element takes following attributes:

  • Attribute dataType is String
    The type of sequence data


The element has the following contents:


Example:

<convert dataType="codon">
  <alignment idref="alignment5"/>
</convert>


<coordinates> element

This element represents a set of (X,Y,Z) coordinates in KML format


The element has the following contents:


Example:

<coordinates>
  foo
</coordinates>


<correlation> element

This element returns a precision that is the element-wise reciprocal of the child precision.


The element takes following attributes:


The element has the following contents:


Example:

<correlation dimension1="1" dimension2="1">
  <matrixParameter idref="matrixParameter1"/>
</correlation>


<CovarionHKYModel> element

A covarion HKY model.


The element has the following contents:

  • Element named <kappa> containing:
    • Parameter element (exactly one)
      A parameter representing the transition transversion bias
  • Element named <switchingRates> containing:
    • Parameter element (exactly one)
      A parameter representing the rate of change between the different classes
  • Element named <hiddenClassRates> containing:
    • Parameter element (exactly one)
      A parameter representing the rates of the hidden classes relative to the first hidden class.


Example:

<CovarionHKYModel>
 <kappa>
   <compoundParameter idref="compoundParameter4"/>
 </kappa>
 <switchingRates>
   <duplicatedParameter idref="duplicatedParameter10"/>
 </switchingRates>
 <hiddenClassRates>
   <matrixParameter idref="matrixParameter6"/>
 </hiddenClassRates>
</CovarionHKYModel>


<covarionModel> element

A covarion substitution model on binary data and a hidden rate state with two rates.


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <alpha> containing:
  • Element named <switchingRate> containing:


Example:

<covarionModel>
 <frequencies>
   <frequencyModel idref="frequencyModel8"/>
 </frequencies>
 <alpha/>
 <switchingRate/>
</covarionModel>


<CSVexport> element

Write tabular data as an CSV file.


The element takes following attributes:

  • Attribute fileName is String
    The name of a BEAST log file (can not include trees, which should be logged separately
  • Attribute (optional) separator is String
    Values separator (default is tab)


The element has the following contents:

  • Element named <columns> containing:
    • Attribute (optional) all is Boolean
      Dump all columns. default is TRUE when no columns are specified, FALSE otherwise
    • Attribute (optional) rows is Boolean
      Write data in rows (default is columns)
    • TabularData element (exactly one)
    • Element named <CSVcolumn> containing:
      A subset of columns from one source


Example:

<CSVexport fileName="foo" separator="foo">
 <columns all="true" rows="true">
   <logFileTrace idref="logFileTrace5"/>
  <CSVcolumn name="foo bar">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/>
  </CSVcolumn>
  <CSVcolumn name="foo bar">
    <diagonalMatrix idref="diagonalMatrix4"/>
  </CSVcolumn>
  <CSVcolumn name="foo bar">
    <compoundParameter idref="compoundParameter6"/>
  </CSVcolumn>
 </columns>
 <columns all="true" rows="true">
   <VDAnalysis idref="VDAnalysis10"/>
  <CSVcolumn name="foo bar">
    <matrixParameter idref="matrixParameter7"/>
  </CSVcolumn>
 </columns>
 <columns all="true" rows="true">
   <logFileTrace idref="logFileTrace1"/>
  <CSVcolumn name="foo bar">
    <compoundParameter idref="compoundParameter8"/>
  </CSVcolumn>
  <CSVcolumn name="foo bar">
    <maskedParameter idref="maskedParameter5"/>
  </CSVcolumn>
 </columns>
 <columns all="true" rows="true">
   <VDAnalysis idref="VDAnalysis1"/>
  <CSVcolumn name="foo bar">
    <maskedParameter idref="maskedParameter10"/>
  </CSVcolumn>
  <CSVcolumn name="foo bar">
    <maskedParameter idref="maskedParameter10"/>
  </CSVcolumn>
  <CSVcolumn name="foo bar">
    <parameter idref="parameter10"/>
  </CSVcolumn>
 </columns>
</CSVexport>


<ctmcScalePrior> element

This element represents the prior for CTMC scale parameter.


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <ctmcScale> containing:


Example:

<ctmcScalePrior>
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel10"/>
 <ctmcScale>
   <duplicatedParameter idref="duplicatedParameter7"/>
 </ctmcScale>
</ctmcScalePrior>


<date> element

Specifies a date on a given timescale


The element takes following attributes:

  • Attribute value is String
    The value of this date
  • Attribute (optional) origin is String
    The origin of this time scale, which must be a valid calendar date
  • Attribute (optional) units is String
    The units of the timescale
  • Attribute (optional) direction is String
    The direction of the timescale


Example:

<!-- a date representing 10 years in the past                                 -->
<date value="10.0" units="years" direction="backwards"/>

<!-- a date representing 300 days after Jan 1st 1989                          -->
<date value="300.0" origin="01/01/89" units="days" direction="forwards"/>


<deltaExchange> element

This element returns a scale operator on a given parameter.


The element takes following attributes:

  • Attribute delta is Double
  • Attribute (optional) parameterWeights is Integer;
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) integer is Boolean


The element has the following contents:


Example:

<deltaExchange delta="1.0" parameterWeights="1 2 4 8" weight="1.0" autoOptimize="true" integer="true">
  <diagonalMatrix idref="diagonalMatrix6"/>
</deltaExchange>


<designMatrix> element

A matrix parameter constructed from its component parameters.


The element takes following attributes:

  • Attribute (optional) addIntercept is Boolean
  • Attribute (optional) form is String
  • Attribute (optional) colDimension is Integer
  • Attribute (optional) rowDimension is Integer


The element has the following contents:


Example:

<designMatrix addIntercept="true" form="foo" colDimension="1" rowDimension="1">
  <parameter idref="parameter8"/>
  <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/>
  <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/>
</designMatrix>


<diagonalMatrix> element

A diagonal matrix parameter constructed from its diagonals.


The element has the following contents:


Example:

<diagonalMatrix>
  <designMatrix idref="designMatrix10"/>
</diagonalMatrix>


<differenceStatistic> element

This element returns a statistic that is the difference of the 2 child statistics.


The element takes following attributes:

  • Attribute (optional) absolute is Boolean


The element has the following contents:

  • Statistic elements (exactly 2)
    The two operand statistics


Example:

<differenceStatistic absolute="true">
  <duplicatedParameter idref="duplicatedParameter5"/>
  <matrixParameter idref="matrixParameter2"/>
</differenceStatistic>


<differenceStatistic> element

This element returns a statistic that is the difference of the 2 child statistics.


The element takes following attributes:

  • Attribute (optional) absolute is Boolean


The element has the following contents:

  • Statistic elements (exactly 2)
    The two operand statistics


Example:

<differenceStatistic absolute="true">
  <RPNcalculator idref="RPNcalculator8"/>
  <negativeStatistic idref="negativeStatistic10"/>
</differenceStatistic>


<diffusionRateStatistic> element

A statistic that returns the average of the branch rates


The element takes following attributes:

  • Attribute (optional) name is String
  • Attribute (optional) greatCircleDistance is Boolean


The element has the following contents:


Example:

<diffusionRateStatistic name="foo" greatCircleDistance="true">
  <multivariateTraitLikelihood idref="multivariateTraitLikelihood2"/>
  <inhibitionLikelihood idref="inhibitionLikelihood9"/>
</diffusionRateStatistic>


<dirichletPrior> element

Calculates the likelihood of some data under an Inverse-Wishart distribution.


The element has the following contents:

  • Element named <countsParameter> containing:


Example:

<dirichletPrior>
 <countsParameter>
   <maskedParameter idref="maskedParameter10"/>
 </countsParameter>
</dirichletPrior>


<DirichletSiteModel> element

A SiteModel that has Dirichlet distributed rates across sites


The element has the following contents:

  • Element named <substitutionModel> containing:
  • Element named <rates> containing:


Example:

<DirichletSiteModel>
 <substitutionModel>
   <yangCodonModel idref="yangCodonModel8"/>
 </substitutionModel>
 <rates>
   <maskedParameter idref="maskedParameter7"/>
 </rates>
</DirichletSiteModel>


<dirtyLikelihood> element

This element returns a operator that forces the entire model likelihood recomputation


The element takes following attributes:


The element has the following contents:


Example:

<dirtyLikelihood weight="1.0">
  <discreteTraitRateModel idref="discreteTraitRateModel7"/>
</dirtyLikelihood>


<discreteTraitRateModel> element

This Branch Rate Model takes a discrete trait reconstruction (provided by a TreeTraitProvider) and gives the rate for each branch of the tree based on the child trait of that branch. The rates for each trait value are specified in a multidimensional parameter.


The element takes following attributes:

  • Attribute (optional) traitIndex is Integer
  • Attribute (optional) traitName is String


The element has the following contents:

  • TreeModel element (exactly one)
    The tree model
  • One of:
    • All of:***TreeTraitProvider element (exactly one)
      • The trait provider
      • One of:
        • Attribute dataType is String
          The type of general data
        • DataType element (exactly one)


  • Element named <rate> containing:
    • Parameter element (exactly one)
      The absolute rate of state 0
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The relative rates of state > 0
  • Element named <indicators> containing:
    • Parameter element (exactly one)
      An index that links the state with a rate


Example:

<discreteTraitRateModel traitIndex="1" traitName="foo">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel4"/>
 <rate>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix1"/>
 </rate>
</discreteTraitRateModel>


<discretizedBranchRates> element

This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.


The element takes following attributes:

  • Attribute (optional) singleRootRate is Boolean
    Whether only a single rate should be used for the two children branches of the root
  • Attribute (optional) overSampling is Integer
    The integer factor for oversampling the distribution model (1 means no oversampling)
  • Attribute (optional) normalize is Boolean
    Whether the mean rate has to be normalized to a particular value
  • Attribute (optional) normalizeBranchRateTo is Double
    The mean rate to normalize to, if normalizing
  • Attribute (optional) overSampling is Integer
    The integer factor for oversampling the distribution model (1 means no oversampling)


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <distribution> containing:
  • Element named <rateCategories> containing:
    • Parameter element (exactly one)
      The rate categories parameter


Example:

<discretizedBranchRates singleRootRate="true" overSampling="1" normalize="true" normalizeBranchRateTo="1.0" overSampling="1">
  <treeModel idref="treeModel1"/>
 <distribution>
   <exponentialDistributionModel idref="exponentialDistributionModel4"/>
 </distribution>
 <rateCategories>
   <parameter idref="parameter7"/>
 </rateCategories>
</discretizedBranchRates>


<discretizedLocationOperator> element

This element returns a multivariate Gibbs operator on traits for possible all nodes.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) onlyInternalNodes is Boolean
  • Attribute (optional) neighborhoodSize is Integer
  • Attribute (optional) randomize is Boolean


The element has the following contents:


Example:

<discretizedLocationOperator weight="1.0" autoOptimize="true" onlyInternalNodes="true" neighborhoodSize="1" randomize="true">
  <multivariateTraitLikelihood idref="multivariateTraitLikelihood8"/>
</discretizedLocationOperator>


<distanceMatrix> element

Constructs a distance matrix from a pattern list or alignment


The element takes following attributes:

  • Attribute correction is String
    The type of distance correction used


The element has the following contents:


Example:

<distanceMatrix correction="F84">
  <sequenceSimulator idref="sequenceSimulator4"/>
</distanceMatrix>


<distributionLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.


The element has the following contents:


Example:

<distributionLikelihood>
 <distribution>
   <inverseGaussianDistributionModel idref="inverseGaussianDistributionModel9"/>
 </distribution>
 <data from="1" to="1">
   <treeMetricStatistic idref="treeMetricStatistic1"/>
   <sumStatistic idref="sumStatistic10"/>
   <speciesTreeStatistic idref="speciesTreeStatistic9"/>
   <notStatistic idref="notStatistic4"/>
 </data>
</distributionLikelihood>


<double> element

returns a Double. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as a Double.


The element has the following contents:

  • One of:
    • Attribute prompt is String
      A message displayed to the user when entering a value for this double
    • Double element (exactly one)


Example:

<double>
  1.0
</double>


<dummyLikelihood> element

A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.


The element has the following contents:

  • Model element (exactly one)
    A model element


Example:

<dummyLikelihood>
  <TN93Model idref="TN93Model8"/>
</dummyLikelihood>


<dummyModel> element

A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.


The element has the following contents:


Example:

<dummyModel>
  <maskedParameter idref="maskedParameter4"/>
  <diagonalMatrix idref="diagonalMatrix7"/>
  <compoundSymmetricMatrix idref="compoundSymmetricMatrix2"/>
</dummyModel>


<duplicatedParameter> element

A duplicated parameter.


The element has the following contents:

  • Parameter element (exactly one)
  • Element named <copies> containing:


Example:

<duplicatedParameter>
  <designMatrix idref="designMatrix9"/>
 <copies>
   <designMatrix idref="designMatrix7"/>
 </copies>
</duplicatedParameter>


<empiricalDistributionLikelihood> element

Calculates the likelihood of some data given some empirically-generated distribution.


The element takes following attributes:

  • Attribute fileName is String
  • Attribute (optional) splineInterpolation is Boolean
  • Attribute (optional) degree is Integer
  • Attribute (optional) inverse is Boolean
  • Attribute (optional) readByColumn is Boolean


The element has the following contents:

  • Element named <data> containing:


Example:

<empiricalDistributionLikelihood fileName="foo" splineInterpolation="true" degree="1" inverse="true" readByColumn="true">
 <data from="1" to="1" offset="1.0">
   <reciprocalStatistic idref="reciprocalStatistic5"/>
 </data>
</empiricalDistributionLikelihood>


<empiricalPiecewise> element

This element represents a piecewise population model


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <intervalWidths> containing:
  • Element named <populationSizes> containing:
    • Parameter element (exactly one)
      The effective population sizes of each interval.
  • Element named <generationLength> containing:
    • Parameter element (exactly one)
      The scale factor.
  • Element named <threshold> containing:
    • Parameter element (exactly one)
      The threshold before counts occur.
  • Element named <lag> containing:
    • Parameter element (exactly one)
      The lag between actual population sizes and genetic diversity.


Example:

<empiricalPiecewise units="days">
 <intervalWidths values="0.5 1.0"/>
 <populationSizes>
   <compoundParameter idref="compoundParameter3"/>
 </populationSizes>
 <generationLength>
   <compoundParameter idref="compoundParameter5"/>
 </generationLength>
 <threshold>
   <maskedParameter idref="maskedParameter7"/>
 </threshold>
 <lag>
   <compoundParameter idref="compoundParameter8"/>
 </lag>
</empiricalPiecewise>


<empiricalTreeDistributionModel> element

Read a list of trees from a NEXUS file.


The element takes following attributes:

  • Attribute fileName is String
    The name of a NEXUS tree file


The element has the following contents:


Example:

<empiricalTreeDistributionModel fileName="foo">
  <attributePatterns idref="attributePatterns2"/>
</empiricalTreeDistributionModel>


<empiricalTreeDistributionOperator> element

Operator which switches between trees in an empirical distribution.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) metropolisHastings is Boolean


The element has the following contents:


Example:

<empiricalTreeDistributionOperator weight="1.0" metropolisHastings="true">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/>
</empiricalTreeDistributionOperator>


<exponentialStatistic> element

This element returns a statistic that is the element-wise exponentiation of the child statistic.


The element has the following contents:


Example:

<exponentialStatistic>
  <parsimonyStateStatistic idref="parsimonyStateStatistic8"/>
</exponentialStatistic>


<expansion> element

A demographic model of constant population size followed by exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <ancestralPopulationProportion> containing:
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time.


Example:

<expansion units="mutations">
 <populationSize>
   <duplicatedParameter idref="duplicatedParameter4"/>
 </populationSize>
 <ancestralPopulationProportion>
   <duplicatedParameter idref="duplicatedParameter2"/>
 </ancestralPopulationProportion>
 <growthRate>
   <matrixParameter idref="matrixParameter1"/>
 </growthRate>
</expansion>


<expConstExp> element

A demographic model of exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <relativePlateauSize> containing:
    • Parameter element (exactly one)
      The size of plateau relative to modern population size.
  • Element named <relTimeModGrowth> containing:
    • Parameter element (exactly one)
      The time spanned by modern growth phase relative to time back to start of plateau phase.
  • Element named <plateauStartTime> containing:
    • Parameter element (exactly one)
      The time of the start of plateauPhase.
  • Element named <ancientGrowthRate> containing:
    • Parameter element (exactly one)
      The growth rate of early growth phase


Example:

<expConstExp units="generations">
 <populationSize>
   <duplicatedParameter idref="duplicatedParameter10"/>
 </populationSize>
 <relativePlateauSize>
   <diagonalMatrix idref="diagonalMatrix3"/>
 </relativePlateauSize>
 <relTimeModGrowth>
   <designMatrix idref="designMatrix9"/>
 </relTimeModGrowth>
 <plateauStartTime>
   <matrixParameter idref="matrixParameter5"/>
 </plateauStartTime>
 <ancientGrowthRate>
   <parameter idref="parameter6"/>
 </ancientGrowthRate>
</expConstExp>


<exponentialBranchLengthsPrior> element

This element represents a tree prior assuming exponentially distributed branch lengths.


The element has the following contents:


Example:

<exponentialBranchLengthsPrior>
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8"/>
</exponentialBranchLengthsPrior>


<exponentialDistributionModel> element

A model of an exponential distribution.


The element takes following attributes:

  • Attribute (optional) offset is Double


The element has the following contents:

  • One of:
    • Element named <mean> containing:
    • Element named <mean> containing:


Example:

<exponentialDistributionModel offset="1.0">
 <mean>
   1.0
 </mean>
</exponentialDistributionModel>


<exponentialGrowth> element

A demographic model of exponential growth.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time.


Example:

<exponentialGrowth units="mutations">
 <populationSize>
   <compoundParameter idref="compoundParameter3"/>
 </populationSize>
 <doublingTime>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix8"/>
 </doublingTime>
</exponentialGrowth>


<exponentialLogistic> element

A demographic model of constant population size followed by logistic growth.


The element takes following attributes:

  • Attribute units is String
    the units
  • Attribute alpha is Double


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <logisticGrowthRate> containing:
  • Element named <logisticShape> containing:
  • Element named <exponentialGrowthRate> containing:
  • Element named <transitionTime> containing:


Example:

<exponentialLogistic units="days" alpha="1.0">
 <populationSize>
   <maskedParameter idref="maskedParameter5"/>
 </populationSize>
 <logisticGrowthRate>
   <parameter idref="parameter4"/>
 </logisticGrowthRate>
 <logisticShape>
   <duplicatedParameter idref="duplicatedParameter2"/>
 </logisticShape>
 <exponentialGrowthRate>
   <matrixParameter idref="matrixParameter7"/>
 </exponentialGrowthRate>
 <transitionTime>
   <designMatrix idref="designMatrix5"/>
 </transitionTime>
</exponentialLogistic>


<exponentialMarkovLikelihood> element

A continuous state, discrete time markov chain in which each new state is an exponentially distributed variable with a mean of the previous state.


The element takes following attributes:

  • Attribute (optional) jeffreys is Boolean
  • Attribute (optional) reverse is Boolean


The element has the following contents:

  • Element named <chainParameter> containing:


Example:

<exponentialMarkovLikelihood jeffreys="true" reverse="true">
 <chainParameter>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/>
 </chainParameter>
</exponentialMarkovLikelihood>


<exponentialPrior> element

Calculates the prior probability of some data under a given exponential distribution.


The element takes following attributes:

  • Attribute mean is Double
  • Attribute (optional) offset is Double


The element has the following contents:


Example:

<exponentialPrior mean="1.0" offset="1.0">
  <speciesTreeStatistic idref="speciesTreeStatistic3"/>
  <treeLengthStatistic idref="treeLengthStatistic1"/>
  <negativeStatistic idref="negativeStatistic4"/>
  <argTimingStatistic idref="argTimingStatistic4"/>
</exponentialPrior>


<exponentialSawtooth> element

A demographic model of succesive exponential growth and periodic population crashes.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
  • Element named <growthRate> containing:
    • Parameter element (exactly one)
      The rate of exponential growth during the growth phase.
  • Element named <wavelength> containing:
    • Parameter element (exactly one)
      The wavelength between successive population crashes.
  • Element named <offset> containing:
    • Parameter element (exactly one)
      The proportion of the last growth phase that is not achieved at the final sample time.


Example:

<exponentialSawtooth units="generations">
 <populationSize>
   <parameter idref="parameter5"/>
 </populationSize>
 <growthRate>
   <matrixParameter idref="matrixParameter6"/>
 </growthRate>
 <wavelength>
   <maskedParameter idref="maskedParameter7"/>
 </wavelength>
 <offset>
   <designMatrix idref="designMatrix5"/>
 </offset>
</exponentialSawtooth>


<exponentialStatistic> element

This element returns a statistic that is the element-wise exponentiation of the child statistic.


The element has the following contents:


Example:

<exponentialStatistic>
  <varianceStatistic idref="varianceStatistic8"/>
</exponentialStatistic>


<expressionStatistic> element

This element returns a statistic that is the mean of the child statistics.


The element has the following contents:

  • Element named <expression> containing:
  • Element named <variables> containing:


Example:

<expressionStatistic>
 <expression>
   foo
 </expression>
 <variables>
   <differenceStatistic idref="differenceStatistic5"/>
   <popGraph idref="popGraph9"/>
   <exponentialStatistic idref="exponentialStatistic10"/>
   <argTreeCount idref="argTreeCount1"/>
 </variables>
</expressionStatistic>


<extendedDataType> element

This element represents an instance of the MutationDeathType which extends a base datatype with an additional "death" state.


The element takes following attributes:

  • Attribute (optional) dataType is String
    Base datatype name


The element has the following contents:

  • DataType element (zero or one)
  • Element named <deathState> containing:
  • Element named <extantState> containing:
    <ambiguity code="Z" states="XY"/>

Example:

<extendedDataType dataType="codon-ascidianMitochondrial"/>


<externalLengthStatistic> element

A statistic that has as its value(s) the length of the external branch length(s) of a set of one or more taxa in a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:


Example:

<externalLengthStatistic name="foo">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel7"/>
  <taxa idref="taxa9"/>
</externalLengthStatistic>


<FixedNodeheightSubtreePruneRegraft> element

This element represents a FNPR operator. This operator swaps a random subtree with its uncle.


The element takes following attributes:


The element has the following contents:


Example:

<FixedNodeheightSubtreePruneRegraft weight="1.0">
  <treeModel idref="treeModel1"/>
</FixedNodeheightSubtreePruneRegraft>


<flatGeoSpatialPrior> element

Calculates the likelihood of some data under a 2D geospatial distribution.


The element takes following attributes:

  • Attribute (optional) taxon is String
  • Attribute (optional) inside is Boolean
  • Attribute (optional) union is Boolean


The element has the following contents:

  • Element named <data> containing:


Example:

<flatGeoSpatialPrior taxon="foo" inside="true" union="true" kmlFileName="foo">
 <data>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/>
 </data>
</flatGeoSpatialPrior>


<frequencyModel> element

A model of equilibrium base frequencies.


The element takes following attributes:

  • Attribute (optional) normalize is Boolean


The element has the following contents:

  • PatternList element (zero or one)
    Initial value
  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <frequencies> containing:


Example:

<frequencyModel normalize="true">
  <hiddenNucleotides idref="hiddenNucleotides1"/>
 <frequencies>
   <duplicatedParameter idref="duplicatedParameter3"/>
 </frequencies>
</frequencyModel>


<gammaDistributionModel> element

A model of a gamma distribution.


The element has the following contents:

  • One of:
    • Element named <shape> containing:
    • Element named <shape> containing:
  • One of:
    • Element named <scale> containing:
    • Element named <scale> containing:


Example:

<gammaDistributionModel>
 <shape>
   <diagonalMatrix idref="diagonalMatrix9"/>
 </shape>
 <scale>
   1.0
 </scale>
</gammaDistributionModel>


<gammaPrior> element

Calculates the prior probability of some data under a given gamma distribution.


The element takes following attributes:

  • Attribute shape is Double
  • Attribute scale is Double
  • Attribute (optional) offset is Double


The element has the following contents:


Example:

<gammaPrior shape="1.0" scale="1.0" offset="1.0">
  <nodeHeightsStatistic idref="nodeHeightsStatistic10"/>
</gammaPrior>


<generalDataType> element

Defines a general DataType for any number of states


The element has the following contents:

  • Identifiable elements (zero or more)
    <state code="X"/>*:<alias code="Y" state="X"/>*:<ambiguity code="Z" states="XY"/>

Example:

<!-- The XML for a nucleotide data type under this scheme would be -->
<generalDataType id="nucleotides">
	<state code="A"/>
	<state code="C"/>
	<state code="G"/>
	<state code="T"/>
	<alias code="U" state="T"/>
	<ambiguity code="R" states="AG"/>
	<ambiguity code="Y" states="CT"/>
	<ambiguity code="?" states="ACGT"/>
	<ambiguity code="-" states="ACGT"/>
</generalDataType>


<generalizedSkylineGibbsOperator> element

This element returns a Gibbs operator for the joint distribution of population sizes.


The element takes following attributes:

  • Attribute (optional) linear is Boolean
  • Attribute weight is Double
  • Attribute lower is Double
  • Attribute upper is Double
  • Attribute (optional) Jeffreys is Boolean
  • Attribute (optional) reverse is Boolean
  • Attribute (optional) exponentialMarkov is Boolean
  • Attribute shape is Double


The element has the following contents:


Example:

<generalizedSkylineGibbsOperator linear="true" weight="1.0" lower="1.0" upper="1.0" Jeffreys="true" reverse="true" exponentialMarkov="true" shape="1.0">
  <generalizedSkyLineLikelihood idref="generalizedSkyLineLikelihood7"/>
  <diagonalMatrix idref="diagonalMatrix10"/>
</generalizedSkylineGibbsOperator>


<generalizedSkyLineLikelihood> element

This element represents the likelihood of the tree given the population size vector.


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <groupSizes> containing:
  • Element named <populationTree> containing:


Example:

<generalizedSkyLineLikelihood type="foo">
 <populationSizes>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/>
 </populationSizes>
 <groupSizes>
   <parameter idref="parameter3"/>
 </groupSizes>
 <populationTree>
   <treeModel idref="treeModel10"/>
 </populationTree>
</generalizedSkyLineLikelihood>


<generalizedSkylinePopSizeStatistic> element

The pop sizes at the given times


Example:

<generalizedSkylinePopSizeStatistic/>


<generalSubstitutionModel> element

A general reversible model of sequence substitution for any data type.


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <frequencies> containing:
  • Element named <rates> containing:
  • Element named <rateIndicator> containing:


Example:

<generalSubstitutionModel>
  <hiddenNucleotides idref="hiddenNucleotides1"/>
 <frequencies>
   <frequencyModel idref="frequencyModel1"/>
 </frequencies>
 <rates>
   <duplicatedParameter idref="duplicatedParameter7"/>
 </rates>
</generalSubstitutionModel>


<GibbsPruneAndRegraft> element

This element represents a Gibbs sampler implemented through a prune and regraft operator. This operator prunes a random subtree and regrafts it below a node chosen by an importance distribution which is the proportion of the likelihoods of the proposals.


The element takes following attributes:


The element has the following contents:


Example:

<GibbsPruneAndRegraft weight="1.0" pruned="true">
  <treeModel idref="treeModel2"/>
</GibbsPruneAndRegraft>


<GibbsSubtreeSwap> element

This element represents a Gibbs wide exchange operator. This operator swaps two subtrees chosen to their posterior probaility.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) pruned is Boolean


The element has the following contents:


Example:

<GibbsSubtreeSwap weight="1.0" pruned="true">
  <treeModel idref="treeModel4"/>
</GibbsSubtreeSwap>


<glmModel> element

Calculates the generalized linear model likelihood of the dependent parameters given one or more blocks of independent parameters and their design matrix.


The element takes following attributes:

  • Attribute family is String
  • Attribute (optional) checkIdentifiability is Boolean


The element has the following contents:

  • Element named <dependentVariables> containing:
  • Element named <independentVariables> containing:
  • Element named <randomEffects> containing:


Example:

<glmModel family="foo" checkIdentifiability="true">
 <independentVariables>
   <designMatrix idref="designMatrix9"/>
 </independentVariables>
 <independentVariables>
   <designMatrix idref="designMatrix5"/>
 </independentVariables>
 <randomEffects>
   <parameter idref="parameter8"/>
 </randomEffects>
</glmModel>


<glmSubstitutionModel> element

A general model of sequence substitution for any data type where the rates come from the generalized linear model.


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)


Example:

<glmSubstitutionModel dataType="codon-euplotidNuclear">
 <rootFrequencies>
   <frequencyModel idref="frequencyModel4"/>
 </rootFrequencies>
  <multivariateOUModel idref="multivariateOUModel7"/>
</glmSubstitutionModel>


<gmrfBivariateCurveAnalysis> element

Integrates two curves


The element takes following attributes:

  • Attribute fileName1 is String
  • Attribute fileName2 is String
  • Attribute endTime is String
  • Attribute (optional) burnIn is Integer


Example:

<gmrfBivariateCurveAnalysis fileName1="foo" fileName2="foo" endTime="foo" burnIn="1"/>


<gmrfBlockUpdateOperator> element

This element returns a GMRF block-update operator for the joint distribution of the population sizes and precision parameter.


The element takes following attributes:

  • Attribute scaleFactor is Double
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) stopValue is Double
  • Attribute (optional) maxIterations is Integer
  • Attribute (optional) trialVersion is Boolean


The element has the following contents:


Example:

<gmrfBlockUpdateOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" stopValue="1.0" maxIterations="1" trialVersion="true">
  <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood3"/>
</gmrfBlockUpdateOperator>


<gmrfFixedEffectsGibbsOperator> element

This element returns a Gibbs operator for regression coefficients in a GMRF.


The element takes following attributes:


The element has the following contents:


Example:

<gmrfFixedEffectsGibbsOperator weight="1.0">
  <multivariateNormalPrior idref="multivariateNormalPrior7"/>
  <matrixParameter idref="matrixParameter5"/>
  <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood5"/>
</gmrfFixedEffectsGibbsOperator>


<gmrfHeightsStatistic> element

A statistic that returns the heights of each internal node in increasing order (or groups them by a group size parameter)


The element takes following attributes:

  • Attribute (optional) name is String


The element has the following contents:


Example:

<gmrfHeightsStatistic name="foo">
  <gmrfTestLikelihood idref="gmrfTestLikelihood5"/>
</gmrfHeightsStatistic>


<gmrfPopSizeStatistic> element

The pop sizes at the given times


The element takes following attributes:

  • Attribute (optional) from is Double
  • Attribute (optional) to is Double
  • Attribute (optional) number is Integer
  • Attribute (optional) time is Double;


The element has the following contents:


Example:

<gmrfPopSizeStatistic from="1.0" to="1.0" number="1" time="0.5 1.0">
  <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood7"/>
</gmrfPopSizeStatistic>


<gmrfSkyrideLikelihood> element

This element represents the likelihood of the tree given the population size vector.


The element takes following attributes:

  • Attribute (optional) rescaleByRootHeight is Boolean
  • Attribute (optional) randomizeTree is Boolean
  • Attribute (optional) timeAwareSmoothing is Boolean


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <precisionParameter> containing:
  • Element named <populationTree> containing:
  • Element named <groupSizes> containing:


Example:

<gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true">
 <populationSizes>
   <compoundParameter idref="compoundParameter2"/>
 </populationSizes>
 <precisionParameter>
   <diagonalMatrix idref="diagonalMatrix3"/>
 </precisionParameter>
 <populationTree>
   <treeModel idref="treeModel4"/>
   <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8"/>
 </populationTree>
</gmrfSkyrideLikelihood>


<gmrfTestLikelihood> element

This element represents the likelihood of the tree given the population size vector.


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <precisionParameter> containing:
  • Element named <lambdaParameter> containing:


Example:

<gmrfTestLikelihood>
 <populationSizes>
   <compoundParameter idref="compoundParameter2"/>
 </populationSizes>
 <precisionParameter>
   <compoundParameter idref="compoundParameter8"/>
 </precisionParameter>
 <lambdaParameter>
   <diagonalMatrix idref="diagonalMatrix2"/>
 </lambdaParameter>
</gmrfTestLikelihood>


<greatCircleDiffusionModel> element

Describes a bivariate diffusion process using great circle distances.


The element has the following contents:

  • Parameter element (exactly one)
  • Element named <diffusionCoefficient> containing:


Example:

<greatCircleDiffusionModel>
  <parameter idref="parameter3"/>
</greatCircleDiffusionModel>


<gtrCovarionModel> element

A covarion substitution model of langauge evolution with binary data and a hidden rate state with two rates.


The element has the following contents:

  • Element named <rateAC> containing:
    • Parameter element (exactly one)
      relative rate of A<->C substitution
  • Element named <rateAG> containing:
    • Parameter element (exactly one)
      relative rate of A<->G substitution
  • Element named <rateAT> containing:
    • Parameter element (exactly one)
      relative rate of A<->T substitution
  • Element named <rateCG> containing:
    • Parameter element (exactly one)
      relative rate of C<->G substitution
  • Element named <rateCT> containing:
    • Parameter element (exactly one)
      relative rate of C<->T substitution
  • Element named <rateGT> containing:
    • Parameter element (exactly one)
      relative rate of G<->T substitution
  • Element named <hiddenClassRates> containing:
  • Element named <switchingRates> containing:
  • Element named <frequencies> containing:


Example:

<gtrCovarionModel>
 <hiddenClassRates>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/>
 </hiddenClassRates>
 <switchingRates>
   <maskedParameter idref="maskedParameter2"/>
 </switchingRates>
 <frequencies>
   <frequencyModel idref="frequencyModel3"/>
 </frequencies>
</gtrCovarionModel>


<gtrModel> element

A general reversible model of nucleotide sequence substitution.


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <rateAC> containing:
  • Element named <rateAG> containing:
  • Element named <rateAT> containing:
  • Element named <rateCG> containing:
  • Element named <rateCT> containing:
  • Element named <rateGT> containing:


Example:

<!-- A general time reversible model for DNA.                                          -->
<!-- This element must have parameters for exactly five of the six rates               -->
<!-- The sixth rate has an implied value of 1.0 and all other rates are relative to it -->
<!-- This example parameterizes the rate matrix relative to the A<->G transition       -->
<gtrModel id="gtr1">
	<frequencies> <frequencyModel idref="freqs"/> </frequencies>
	<rateAC> <parameter id="rateAC" value="1.0"/> </rateAC>
	<rateAT> <parameter id="rateAT" value="1.0"/> </rateAT>
	<rateCG> <parameter id="rateCG" value="1.0"/> </rateCG>
	<rateCT> <parameter id="rateCT" value="1.0"/> </rateCT>
	<rateGT> <parameter id="rateGT" value="1.0"/> </rateGT>
</gtrModel>


<hiddenNucleotides> element

A nucleotide data type that allows hidden substitution classes


The element takes following attributes:


Example:

<hiddenNucleotides classCount="1"/>


<hierarchicalPartitionLikelihood> element

null


The element has the following contents:


Example:

<hierarchicalPartitionLikelihood>
  <argTreeModel idref="argTreeModel3"/>
</hierarchicalPartitionLikelihood>


<HKYModel> element

This element represents an instance of the HKY85 (Hasegawa, Kishino & Yano, 1985) model of nucleotide evolution.


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <kappa> containing:


Example:

<HKYModel>
 <frequencies>
   <frequencyModel idref="frequencyModel7"/>
 </frequencies>
 <kappa>
   <compoundParameter idref="compoundParameter10"/>
 </kappa>
</HKYModel>


<hypermutantAlignment> element

Converts an alignment so that 'A's at specific APOBEC targeted contexts are set to an A/G ambiguity code.


The element takes following attributes:

  • Attribute type is String
    The type of APOBEC molecule being modelled


The element has the following contents:


Example:

<hypermutantAlignment type="hA3G">
  <convert idref="convert4"/>
</hypermutantAlignment>


<hypermutantErrorModel> element

This element returns a model that allows for APOBEC-type RNA editing.


The element takes following attributes:

  • Attribute (optional) unlinkedRates is Boolean


The element has the following contents:

  • HypermutantAlignment element (exactly one)
  • Element named <hypermutationRate> containing:
    • Parameter element (exactly one)
      The hypermutation rate per target site per sequence
  • Element named <hypermutationIndicators> containing:
    • Parameter element (exactly one)
      A binary indicator of whether the sequence is hypermutated


Example:

<hypermutantErrorModel unlinkedRates="true">
  ERROR!
 <hypermutationRate>
   <compoundParameter idref="compoundParameter3"/>
 </hypermutationRate>
 <hypermutationIndicators>
   <diagonalMatrix idref="diagonalMatrix4"/>
 </hypermutationIndicators>
</hypermutantErrorModel>


<ibdReporter> element

This element represents a reporter for expected number of tips ibd.


The element has the following contents:


Example:

<ibdReporter>
  <treeModel idref="treeModel4"/>
  <lewisMk idref="lewisMk5"/>
  <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/>
</ibdReporter>


<ImportanceNarrowExchange> element

This element represents a swap operator. This operator swaps a random subtree with its uncle.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) epsilon is Double


The element has the following contents:


Example:

<ImportanceNarrowExchange weight="1.0" epsilon="1.0">
  <ascertainedPatterns idref="ascertainedPatterns6"/>
  <treeModel idref="treeModel5"/>
</ImportanceNarrowExchange>


<ImportancePruneAndRegraft> element

This element represents a importance guided prune and regraft operator. This operator prunes a random subtree and regrafts it below a node chosen by an importance distribution.


The element takes following attributes:


The element has the following contents:


Example:

<ImportancePruneAndRegraft weight="1.0" samples="1">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel9"/>
</ImportancePruneAndRegraft>


<ImportanceSubtreeSwap> element

This element represents a importance guided subtree swap operator. This operator swaps a random subtree with a second subtree guided by an importance distribution.


The element takes following attributes:


The element has the following contents:


Example:

<ImportanceSubtreeSwap weight="1.0" samples="1">
  <treeModel idref="treeModel2"/>
</ImportanceSubtreeSwap>


<inhibitionLikelihood> element

Provides the likelihood of a continuous trait evolving on a tree by a given diffusion model.


The element has the following contents:


Example:

<inhibitionLikelihood>
  <treeModel idref="treeModel10"/>
  <compoundSymmetricMatrix idref="compoundSymmetricMatrix8"/>
 <precision>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/>
 </precision>
</inhibitionLikelihood>


<integer> element

returns an Integer. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as an Integer.


The element has the following contents:

  • One of:
    • Attribute prompt is String
      A message displayed to the user when entering a value for this integer
    • Integer element (exactly one)


Example:

<integer>
  1
</integer>


<traitGibbsOperator> element

This element returns a multivariate Gibbs operator on traits for possible all nodes.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) onlyInternalNodes is Boolean
  • Attribute (optional) onlyTipsWithPriors is Boolean


The element has the following contents:


Example:

<traitGibbsOperator weight="1.0" onlyInternalNodes="true" onlyTipsWithPriors="true">
  ERROR!
</traitGibbsOperator>


<invgammaPrior> element

Calculates the prior probability of some data under a given inverse gamma distribution.


The element takes following attributes:


The element has the following contents:


Example:

<invgammaPrior shape="1.0" scale="1.0" offset="1.0">
  <exponentialStatistic idref="exponentialStatistic1"/>
  <gmrfHeightsStatistic idref="gmrfHeightsStatistic3"/>
</invgammaPrior>


<inverseGaussianDistributionModel> element

Describes a inverse gaussian distribution with a given mean and shape (or standard deviation) that can be used in a distributionLikelihood element


The element takes following attributes:

  • Attribute (optional) offset is Double


The element has the following contents:

  • Element named <mean> containing:
  • Element named <stdev> containing:
  • Element named <shape> containing:


Example:

<inverseGaussianDistributionModel offset="1.0">
 <mean>
   <diagonalMatrix idref="diagonalMatrix1"/>
 </mean>
</inverseGaussianDistributionModel>


<invgammaPrior> element

Calculates the prior probability of some data under a given inverse gamma distribution.


The element takes following attributes:


The element has the following contents:


Example:

<invgammaPrior shape="1.0" scale="1.0" offset="1.0">
  <speciesTreeStatistic idref="speciesTreeStatistic6"/>
  <statistic idref="statistic8"/>
  <monophylyStatistic idref="monophylyStatistic8"/>
  <maskedParameter idref="maskedParameter4"/>
</invgammaPrior>


<oneOnXPrior> element

Calculates the (improper) prior proportional to Prod_i (1/x_i) for the given statistic x.


The element has the following contents:

  • One of:
    • Statistic elements (one or more)
    • Element named <data> containing:


Example:

<oneOnXPrior>
 <data>
   <matrixParameter idref="matrixParameter2"/>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/>
   <test idref="test5"/>
 </data>
</oneOnXPrior>


<jointOperator> element

This element represents an arbitrary list of operators; only the first is optimizable


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) targetAcceptance is Double


The element has the following contents:


Example:

<jointOperator weight="1.0" targetAcceptance="1.0">
  <argSubtreeSlide idref="argSubtreeSlide7"/>
  <jointOperator idref="jointOperator8"/>
  <argPartitionOperator idref="argPartitionOperator7"/>
</jointOperator>


<kStateType> element

Parser for k-state model.


The element takes following attributes:

  • Attribute stateCount is Integer
  • Attribute (optional) startWith is Integer


Example:

<kStateType stateCount="1" startWith="1"/>


<laplacePrior> element

Calculates the prior probability of some data under a given laplace distribution.


The element takes following attributes:


The element has the following contents:


Example:

<laplacePrior mean="1.0" stdev="1.0">
  <reciprocalStatistic idref="reciprocalStatistic8"/>
  <correlation idref="correlation3"/>
  <designMatrix idref="designMatrix6"/>
  <treeMetricStatistic idref="treeMetricStatistic10"/>
</laplacePrior>


<lewisMk> element

A parser for Lewis' Mk model


The element takes following attributes:

  • Attribute (optional) totalOrder is Boolean


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <order> containing:


Example:

<lewisMk totalOrder="true">
 <frequencies>
   <frequencyModel idref="frequencyModel5"/>
 </frequencies>
</lewisMk>


<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) threads is Integer


The element has the following contents:


Example:

<compoundLikelihood threads="1">
  <arbitraryBranchRates idref="arbitraryBranchRates8"/>
</compoundLikelihood>


<lineageCountStatistic> element

The element has the following contents:


Example:

<lineageCountStatistic>
  <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood10"/>
</lineageCountStatistic>


<LINEARBIASModel> element

This element represents an instance of the stepwise mutation model of microsatellite evolution.


The element takes following attributes:

  • Attribute (optional) estimateSubmodelParameters is String
    whether or not to esitmate the parameters of the submodel
  • Attribute (optional) logistics is Boolean
  • Attribute (optional) isSubmodel is Boolean


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <Submodel> containing:
  • Microsatellite element (exactly one)
  • Element named <BiasConstant> containing:
  • Element named <BiasLinear> containing:


Example:

<LINEARBIASModel estimateSubmodelParameters="foo" logistics="true" isSubmodel="true">
 <Submodel>
   <LINEARBIASModel idref="LINEARBIASModel8"/>
 </Submodel>
  <microsatellite idref="microsatellite10"/>
</LINEARBIASModel>


<localClockModel> element

This element returns a branch rate model that adds a delta to each terminal branch length.


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rate> containing:
    • Parameter element (exactly one)
      The molecular evolutionary rate parameter
  • Element named <externalBranches> containing:
    • Attribute (optional) relative is Boolean
    • Taxa element (exactly one)
      A local clock that will be applied only to the external branches for these taxa
    • Parameter element (exactly one)
      The rate parameter
  • Element named <clade> containing:
    • Attribute (optional) relative is Boolean
    • Attribute (optional) includeStem is Boolean
      determines whether or not the stem branch above this clade is included in the siteModel (default false).
    • Attribute (optional) excludeClade is Boolean
      determines whether to exclude actual branches of the clade from the siteModel (default false).
    • Taxa element (exactly one)
      A set of taxa which defines a clade to apply a different site model to
    • Parameter element (exactly one)
      The rate parameter
  • Element named <backbone> containing:
    • Attribute (optional) relative is Boolean
    • Taxa element (exactly one)
      A local clock that will be applied only to the 'backbone' branches defined by these taxa
    • Parameter element (exactly one)
      The rate parameter


Example:

<localClockModel>
  <treeModel idref="treeModel2"/>
 <rate>
   <matrixParameter idref="matrixParameter9"/>
 </rate>
 <backbone relative="true">
   <taxa idref="taxa2"/>
   <matrixParameter idref="matrixParameter7"/>
 </backbone>
 <backbone relative="true">
   <taxa idref="taxa4"/>
   <designMatrix idref="designMatrix5"/>
 </backbone>
</localClockModel>


<location> element

Specifies a location with an optional longitude and latitude


The element takes following attributes:

  • Attribute (optional) description is String
    A description of this location
  • Attribute (optional) longitude is String
    The longitude in degrees, minutes, seconds or decimal degrees
  • Attribute (optional) latitude is String
    The latitude in degrees, minutes, seconds or decimal degrees


Example:

<location description="foo" longitude="foo" latitude="foo"/>


<log> element

Logs one or more items at a given frequency to the screen or to a file


The element takes following attributes:

  • Attribute logEvery is Integer
  • Attribute (optional) overwrite is Boolean
  • Attribute (optional) fileName is String
    The name of the file to send log output to. If no file name is specified then log is sent to standard output
  • Attribute (optional) title is String
    The title of the log


The element has the following contents:

  • At least one of:**Columns elements (one or more)


Example:

<log logEvery="1" overwrite="true" fileName="foo" title="foo">
  <column idref="column7"/>
  <column idref="column10"/>
  <column idref="column8"/>
  <column idref="column9"/>
</log>


<logAllTraits> element

null


The element has the following contents:

  • TreeModel element (exactly one)
    The tree which is to be logged


Example:

<logAllTraits>
  <treeModel idref="treeModel9"/>
</logAllTraits>


<logArg> element

Logs an ARG to a file


The element takes following attributes:

  • Attribute logEvery is Integer
  • Attribute format is String
    The type logger's output type
  • Attribute (optional) fileName is String
    The name of the file to send log output to. If no file name is specified then log is sent to standard output
  • Attribute (optional) title is String
    The title of the log


The element has the following contents:

  • ARGModel element (exactly one)
    The ARG which is to be logged


Example:

<!-- The logArg element takes an argModel to be logged -->
<logArg logEvery="100" fileName="log.args">
	<argModel idref="treeModel1"/>
</logArg>


<logArgTree> element

Logs a tree to a file


The element takes following attributes:

  • Attribute logEvery is Integer
  • Attribute partition is Integer
  • Attribute (optional) fileName is String
    The name of the file to send log output to. If no file name is specified then log is sent to standard output
  • Attribute (optional) title is String
    The title of the log
  • Attribute (optional) nexusFormat is Boolean
    Whether to use the NEXUS format for the tree log
  • Attribute (optional) branchLengths is String
    What units should the branch lengths be in


The element has the following contents:


Example:

<!-- The logArgTree element takes an argTreeModel to be logged -->
<logArgTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logArgTree>


<logarithmStatistic> element

This element returns a statistic that is the element-wise natural logarithm of the child statistic.


The element takes following attributes:

  • Attribute (optional) base is Double
    An optional base for the logarithm (default is the natural logarithm, base e)


The element has the following contents:


Example:

<logarithmStatistic base="1.0">
  <compatibilityStatistic idref="compatibilityStatistic2"/>
</logarithmStatistic>


<logarithmStatistic> element

This element returns a statistic that is the element-wise natural logarithm of the child statistic.


The element takes following attributes:

  • Attribute (optional) base is Double
    An optional base for the logarithm (default is the natural logarithm, base e)


The element has the following contents:


Example:

<logarithmStatistic base="1.0">
  <nodeHeightsStatistic idref="nodeHeightsStatistic8"/>
</logarithmStatistic>


<logFileTrace> element

reconstruct population graph from variable dimension run.


The element takes following attributes:

  • Attribute fileName is String
    trace log.
  • Attribute (optional) burnIn is Integer
    The number of states (not sampled states, but actual states) that are discarded from the beginning of the trace before doing the analysis


Example:

<logFileTrace fileName="foo" burnIn="1"/>


<loggableStatistic> element

Allows you to choose specific dimensions of a given statistic


The element has the following contents:


Example:

<loggableStatistic>
  <parsimonyStatistic idref="parsimonyStatistic3"/>
</loggableStatistic>


<logisticGrowth> element

Logistic growth demographic model.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <populationSize> containing:
    • Parameter element (exactly one)
      This parameter represents the carrying capacity (maximum population size). If the shape is very large then the current day population size will be very close to the carrying capacity.
  • One of:
    • Element named <growthRate> containing:
      • Parameter element (exactly one)
        This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.
    • Element named <doublingTime> containing:
      • Parameter element (exactly one)
        This parameter determines the doubling time at peak growth rate.
  • Element named <t50> containing:
    • Parameter element (exactly one)
      This parameter represents the time in the past when the population had half of the carrying capacity (population size). It is therefore a positive number with the same units as divergence times. A scale operator is recommended with a starting value near zero. A lower bound of zero should be employed and an upper bound is required!


Example:

<logisticGrowth units="substitutions">
 <populationSize>
   <designMatrix idref="designMatrix10"/>
 </populationSize>
 <doublingTime>
   <designMatrix idref="designMatrix2"/>
 </doublingTime>
 <t50>
   <maskedParameter idref="maskedParameter5"/>
 </t50>
</logisticGrowth>


<logML> element

Logs one or more items every time the given likelihood improves


The element takes following attributes:

  • Attribute (optional) logEvery is Integer


The element has the following contents:

  • Element named <ml> containing:
  • At least one of:**Columns elements (one or more)


Example:

<logML logEvery="1">
 <ml>
   <ovariableSkyLineLikelihood idref="ovariableSkyLineLikelihood4"/>
 </ml>
  <column idref="column3"/>
  <column idref="column4"/>
</logML>


<logNormalDistributionModel> element

Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element


The element takes following attributes:

  • Attribute (optional) meanInRealSpace is Boolean
  • Attribute (optional) offset is Double


The element has the following contents:

  • Element named <mean> containing:
  • One of:
    • Element named <stdev> containing:
    • Element named <precision> containing:


Example:

<logNormalDistributionModel meanInRealSpace="true" offset="1.0">
 <mean>
   1.0
 </mean>
 <precision>
   <diagonalMatrix idref="diagonalMatrix7"/>
 </precision>
</logNormalDistributionModel>


<logNormalPrior> element

Calculates the prior probability of some data under a given lognormal distribution.


The element takes following attributes:

  • Attribute mean is Double
  • Attribute stdev is Double
  • Attribute (optional) offset is Double
  • Attribute (optional) meanInRealSpace is Boolean


The element has the following contents:


Example:

<logNormalPrior mean="1.0" stdev="1.0" offset="1.0" meanInRealSpace="true">
  <rateCovarianceStatistic idref="rateCovarianceStatistic1"/>
  <lineageCountStatistic idref="lineageCountStatistic1"/>
  <speciesTreeStatistic idref="speciesTreeStatistic3"/>
  <expressionStatistic idref="expressionStatistic1"/>
</logNormalPrior>


<logRandomWalkOperator> element

This element returns a scale operator on a given parameter.


The element takes following attributes:

  • Attribute window is Double
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) scaleAll is Boolean
  • Attribute (optional) scaleAllIndependently is Boolean


The element has the following contents:


Example:

<logRandomWalkOperator window="1.0" weight="1.0" autoOptimize="true" scaleAll="true" scaleAllIndependently="true">
  <parameter idref="parameter7"/>
</logRandomWalkOperator>


<logTree> element

Logs a tree to a file


The element takes following attributes:

  • Attribute (optional) logEvery is Integer
  • Attribute (optional) overwrite is Boolean
  • Attribute (optional) fileName is String
    The name of the file to send log output to. If no file name is specified then log is sent to standard output
  • Attribute (optional) title is String
    The title of the log
  • Attribute (optional) nexusFormat is Boolean
    Whether to use the NEXUS format for the tree log
  • Attribute (optional) sortTranslationTable is Boolean
    Whether the translation table is sorted.
  • Attribute (optional) branchLengths is String
    What units should the branch lengths be in
  • Attribute (optional) mapNamesToNumbers is Boolean
  • Attribute (optional) dp is Integer


The element has the following contents:


Example:

<!-- The logTree element takes a treeModel to be logged -->
<logTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logTree>


<marginalLikelihoodAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.


The element takes following attributes:

  • Attribute fileName is String
    The traceName of a BEAST log file (can not include trees, which should be logged separately
  • Attribute (optional) burnIn is Integer


The element has the following contents:

  • Element named <likelihoodColumn> containing:
    • Attribute name is String
      The column name


Example:

<marginalLikelihoodAnalysis fileName="foo" burnIn="1">
 <likelihoodColumn name="foo"/>
</marginalLikelihoodAnalysis>


<ancestralTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) storePartials is Boolean
  • Attribute (optional) tagName is String
  • Attribute (optional) forceRescaling is Boolean
  • Attribute (optional) useMAP is Boolean
  • Attribute (optional) useMarginalLikelihood is Boolean


The element has the following contents:


Example:

<ancestralTreeLikelihood useAmbiguities="true" storePartials="true" tagName="foo" forceRescaling="true" useMAP="true" useMarginalLikelihood="true">
  <sequenceSimulator idref="sequenceSimulator8"/>
  <treeModel idref="treeModel3"/>
  <DirichletSiteModel idref="DirichletSiteModel9"/>
  <aminoAcidModel idref="aminoAcidModel2"/>
</ancestralTreeLikelihood>


<maskedParameter> element

A masked parameter.


The element takes following attributes:

  • Attribute (optional) complement is Boolean


The element has the following contents:

  • Parameter element (exactly one)
  • Element named <mask> containing:


Example:

<maskedParameter complement="true">
  <maskedParameter idref="maskedParameter9"/>
 <mask>
   <designMatrix idref="designMatrix10"/>
 </mask>
</maskedParameter>


<matrixParameter> element

A matrix parameter constructed from its component parameters.


The element has the following contents:


Example:

<matrixParameter>
  <compoundSymmetricMatrix idref="compoundSymmetricMatrix4"/>
</matrixParameter>


<mcmc> element

This element returns an MCMC chain and runs the chain as a side effect.


The element takes following attributes:

  • Attribute chainLength is Integer
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) autoOptimizeDelay is Integer
  • Attribute (optional) preBurnin is Integer
  • Attribute (optional) temperature is Double
  • Attribute (optional) fullEvaluation is Integer
  • Attribute (optional) minOpsFullEvaluations is Integer
  • Attribute (optional) spawn is Boolean
  • Attribute (optional) name is String
  • Attribute (optional) operatorAnalysis is String


The element has the following contents:


Example:

<mcmc chainLength="1" autoOptimize="true" autoOptimizeDelay="1" preBurnin="1" temperature="1.0" fullEvaluation="1" minOpsFullEvaluations="1" spawn="true" name="foo" operatorAnalysis="foo">
  <operators idref="operators9"/>
  <booleanLikelihood idref="booleanLikelihood8"/>
  <log idref="log4"/>
</mcmc>


<meanStatistic> element

This element returns a statistic that is the mean of the child statistics.


The element has the following contents:


Example:

<meanStatistic>
  <meanStatistic idref="meanStatistic9"/>
  <notStatistic idref="notStatistic8"/>
  <treeLengthStatistic idref="treeLengthStatistic7"/>
</meanStatistic>


<mergePatterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.


The element has the following contents:


Example:

<mergePatterns>
  <convert idref="convert2"/>
  <hypermutantAlignment idref="hypermutantAlignment9"/>
</mergePatterns>


<microsatellite> element

This element represents a microsatellite data type.


The element has the following contents:


Example:

<microsatellite min="0" max="20" unitLength="2"/>


<microsatellitePattern> element

This element represents a microsatellite pattern.


The element takes following attributes:

  • Attribute id is String
    the name of the locus
  • Attribute (optional) printDetails is Boolean
  • Attribute (optional) printMsatPatContent is Boolean


The element has the following contents:

  • Taxa element (exactly one)
  • Microsatellite element (exactly one)
  • Element named <microsatSeq> containing:
    • String element (exactly one)
      A string of numbers representing the microsatellite lengths for a locus


Example:

<microsatellitePattern id="foo" printDetails="true" printMsatPatContent="true">
  <taxa idref="taxa9"/>
  <microsatellite idref="microsatellite7"/>
 <microsatSeq>
   1,2,3,4,5,67,100
 </microsatSeq>
</microsatellitePattern>


<microsatelliteSamplerTreeLikelihood> element

this parser returns an object of the TreeMicrosatelliteSamplerLikelihood class


The element has the following contents:


Example:

<microsatelliteSamplerTreeLikelihood>
  <microsatelliteSamplerTreeModel idref="microsatelliteSamplerTreeModel9"/>
  <LINEARBIASModel idref="LINEARBIASModel8"/>
</microsatelliteSamplerTreeLikelihood>


<microsatelliteSamplerTreeModel> element

This parser returns a TreeMicrosatelliteSamplerModel Object


The element takes following attributes:

  • Attribute (optional) provideInternalNodeValues is Boolean


The element has the following contents:

  • Element named <tree> containing:
  • Element named <internalValues> containing:
  • Element named <externalValues> containing:


Example:

<microsatelliteSamplerTreeModel provideInternalNodeValues="true">
 <tree>
   <treeModel idref="treeModel10"/>
 </tree>
 <internalValues>
   <matrixParameter idref="matrixParameter5"/>
 </internalValues>
 <externalValues>
   <microsatellitePattern idref="microsatellitePattern10"/>
 </externalValues>
</microsatelliteSamplerTreeModel>


<microsatelliteSimulator> element

This parser facilliates simulation of microsatellites given a tree and infinitesimal rate model


The element has the following contents:


Example:

<microsatelliteSimulator>
  <microsatellite idref="microsatellite2"/>
  <taxa idref="taxa4"/>
  <neighborJoiningTree idref="neighborJoiningTree6"/>
  <LINEARBIASModel idref="LINEARBIASModel3"/>
</microsatelliteSimulator>


<microsatUpDownOperator> element

This element represents an operator that scales two parameters in different directions. Each operation involves selecting a scale uniformly at random between scaleFactor and 1/scaleFactor. The up parameter is multipled by this scale and the down parameter is divided by this scale.


The element takes following attributes:

  • Attribute scaleFactor is Double
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:

  • Element named <up> containing:
  • Element named <down> containing:


Example:

<microsatUpDownOperator scaleFactor="1.0" weight="1.0" autoOptimize="true">
 <up/>
 <up/>
 <down/>
 <down/>
 <down/>
</microsatUpDownOperator>


<mixedDistributionLikelihood> element

Calculates the likelihood of some data given some mix of parametric distributions.


The element has the following contents:


Example:

<mixedDistributionLikelihood>
 <distribution0>
   <gammaDistributionModel idref="gammaDistributionModel9"/>
 </distribution0>
 <distribution1>
   <normalDistributionModel idref="normalDistributionModel5"/>
 </distribution1>
 <data>
   <gmrfHeightsStatistic idref="gmrfHeightsStatistic6"/>
 </data>
 <indicators>
   <monotonicStatistic idref="monotonicStatistic9"/>
 </indicators>
</mixedDistributionLikelihood>


<mixtureCartogramDiffusionModel> element

Describes a bivariate diffusion process using cartogram distances.


The element has the following contents:

  • Parameter element (exactly one)
  • Element named <mixture> containing:
  • Element named <boundingBox> containing:


Example:

<mixtureCartogramDiffusionModel>
  <maskedParameter idref="maskedParameter7"/>
 <mixture>
   <maskedParameter idref="maskedParameter6"/>
 </mixture>
 <boundingBox minX="1.0" maxX="1.0" minY="1.0" maxY="1.0"/>
</mixtureCartogramDiffusionModel>


<mixtureModel> element

This element represents a discrete mixture of tree likelihood models.


The element takes following attributes:

  • Attribute (optional) normalize is Boolean


The element has the following contents:


Example:

<mixtureModel normalize="true">
  <cachedPrior idref="cachedPrior7"/>
  <dirichletPrior idref="dirichletPrior1"/>
  <diagonalMatrix idref="diagonalMatrix7"/>
</mixtureModel>


<mixtureModelBranchRates> element

This element returns a random discretized relaxed clock model.The branch rates are drawn from a continuous parametric distribution.


The element takes following attributes:

  • Attribute (optional) singleRootRate is Boolean
    Whether only a single rate should be used for the two children branches of the root
  • Attribute (optional) normalize is Boolean
    Whether the mean rate has to be normalized to a particular value
  • Attribute (optional) normalizeBranchRateTo is Double
    The mean rate to normalize to, if normalizing
  • Attribute (optional) useQuantilesForRates is Boolean
    Whether or not to use quantiles to represent rates. If false then rates are not drawn specifically from any of the distributions


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <distribution> containing:
  • Element named <distributionIndex> containing:
    • Parameter element (exactly one)
      Operator that switches between the distributions of the branch rate distribution model
  • Element named <rateCategoryQuantiles> containing:
    • Parameter element (exactly one)
      The quantiles for


Example:

<mixtureModelBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0" useQuantilesForRates="true">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6"/>
 <distribution>
   <uniformDistributionModel idref="uniformDistributionModel6"/>
 </distribution>
 <distribution>
   <uniformDistributionModel idref="uniformDistributionModel9"/>
 </distribution>
 <distribution>
   <uniformDistributionModel idref="uniformDistributionModel4"/>
 </distribution>
 <distributionIndex>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/>
 </distributionIndex>
 <rateCategoryQuantiles>
   <designMatrix idref="designMatrix2"/>
 </rateCategoryQuantiles>
</mixtureModelBranchRates>


<mkSubstitutionModel> element

An Mk model of substitution. This model can also accomodate arbitrary orderings of changes.


The element has the following contents:

  • Element named <frequencies> containing:


Example:

<mkSubstitutionModel>
 <frequencies>
   <frequencyModel idref="frequencyModel7"/>
 </frequencies>
</mkSubstitutionModel>


<modelSpecificPseudoPrior> element

Calculates the likelihood of some data given some parametric or empirical distribution.


Example:

<modelSpecificPseudoPrior/>


<monophylyStatistic> element

A statistic that returns true if a given set of taxa are monophyletic for a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic for the purpose of logging


The element has the following contents:

  • Tree element (exactly one)
  • Element named <mrca> containing:
    • One of:
      • Taxon elements (one or more)
      • Taxa element (exactly one)
  • Element named <ignore> containing:
    • One of:
      • Taxon elements (one or more)
      • Taxa element (exactly one)
    • An optional list of taxa to ignore from the test of monophyly


Example:

<monophylyStatistic name="foo">
  <newick idref="newick1"/>
 <mrca>
   <taxon idref="taxon9"/>
 </mrca>
</monophylyStatistic>


<monotonicStatistic> element

The element takes following attributes:

  • Attribute (optional) order is String
  • Attribute (optional) strictlyMonotic is Boolean


The element has the following contents:


Example:

<monotonicStatistic order="foo" strictlyMonotic="true">
  <loggableStatistic idref="loggableStatistic6"/>
  <differenceStatistic idref="differenceStatistic7"/>
  <monotonicStatistic idref="monotonicStatistic10"/>
  <expressionStatistic idref="expressionStatistic8"/>
</monotonicStatistic>


<mrcaTraitStatistic> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging
  • Attribute trait is String
    The name of the trait (can be rate)
  • Attribute (optional) rate is Boolean


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <mrca> containing:
    • Taxa element (exactly one)


Example:

<mrcaTraitStatistic name="foo" trait="foo" rate="true">
  <treeModel idref="treeModel5"/>
 <mrca>
   <taxa idref="taxa2"/>
 </mrca>
</mrcaTraitStatistic>


<msatAvgSubsetModel> element

This element represents an instance of the Microsatellite Averaging Model of microsatellite evolution.


The element takes following attributes:

  • Attribute (optional) logit is Boolean


The element has the following contents:

  • Microsatellite element (exactly one)
  • Element named <models> containing:
    • Element named <model> containing:
  • Element named <rateProps> containing:
    • Element named <rateProp> containing:
  • Element named <biasConsts> containing:
    • Element named <biasConst> containing:
  • Element named <biasLins> containing:
    • Element named <biasLin> containing:
  • Element named <geos> containing:
    • Element named <geo> containing:
  • Element named <modelChoose> containing:
  • Element named <modelIndicator> containing:


Example:

<msatAvgSubsetModel logit="true">
  <microsatellite idref="microsatellite3"/>
 <models>
  <model binary="foo" code="foo"/>
  <model binary="foo" code="foo"/>
 </models>
 <rateProps>
  <rateProp inModels="1 2 4 8">
    <diagonalMatrix idref="diagonalMatrix8"/>
  </rateProp>
  <rateProp inModels="1 2 4 8">
    <designMatrix idref="designMatrix7"/>
  </rateProp>
  <rateProp inModels="1 2 4 8">
    <maskedParameter idref="maskedParameter10"/>
  </rateProp>
 </rateProps>
 <biasConsts>
  <biasConst inModels="1 2 4 8">
    <designMatrix idref="designMatrix5"/>
  </biasConst>
  <biasConst inModels="1 2 4 8">
    <designMatrix idref="designMatrix6"/>
  </biasConst>
  <biasConst inModels="1 2 4 8">
    <matrixParameter idref="matrixParameter8"/>
  </biasConst>
 </biasConsts>
 <biasLins>
  <biasLin inModels="1 2 4 8">
    <maskedParameter idref="maskedParameter1"/>
  </biasLin>
 </biasLins>
 <geos>
  <geo inModels="1 2 4 8">
    <matrixParameter idref="matrixParameter10"/>
  </geo>
  <geo inModels="1 2 4 8">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix5"/>
  </geo>
 </geos>
 <modelChoose>
   <maskedParameter idref="maskedParameter7"/>
 </modelChoose>
 <modelIndicator>
   <duplicatedParameter idref="duplicatedParameter3"/>
 </modelIndicator>
</msatAvgSubsetModel>


<msatModelSelectOperator> element

This element returns a microsatellite averaging operator on a given parameter.


The element takes following attributes:


The element has the following contents:

  • Element named <modelChoose> containing:
  • Element named <modelIndicators> containing:


Example:

<msatModelSelectOperator weight="1.0">
 <modelChoose>
   <matrixParameter idref="matrixParameter2"/>
 </modelChoose>
 <modelIndicators>
   <duplicatedParameter idref="duplicatedParameter7"/>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix7"/>
 </modelIndicators>
</msatModelSelectOperator>


<msatModelSwitchOperator> element

This element returns a microsatellite averaging operator on a given parameter.


The element takes following attributes:


The element has the following contents:

  • Element named <modelChoose> containing:
  • Element named <dependencies> containing:


Example:

<msatModelSwitchOperator weight="1.0">
 <modelChoose>
   <diagonalMatrix idref="diagonalMatrix8"/>
 </modelChoose>
 <dependencies>
   <designMatrix idref="designMatrix8"/>
 </dependencies>
</msatModelSwitchOperator>


<multiLociDistance> element

Constructs a distance matrix from a pattern list or alignment


The element has the following contents:


Example:

<multiLociDistance>
  <distanceMatrix idref="distanceMatrix7"/>
  <distanceMatrix idref="distanceMatrix6"/>
</multiLociDistance>


<multivariateDiffusionModel> element

Describes a multivariate normal diffusion process.


The element has the following contents:

  • Element named <precisionMatrix> containing:


Example:

<multivariateDiffusionModel>
 <precisionMatrix>
   <matrixParameter idref="matrixParameter5"/>
 </precisionMatrix>
</multivariateDiffusionModel>


<multivariateGammaPrior> element

Calculates the likelihood of some data under a given multivariate-gamma distribution.


The element has the following contents:

  • One of:
    • Element named <shapeParameter> containing:
    • Element named <meanParameter> containing:
  • One of:
    • Element named <scaleParameter> containing:
    • Element named <coefficientOfVariation> containing:
  • Element named <data> containing:


Example:

<multivariateGammaPrior>
 <meanParameter>
   <compoundParameter idref="compoundParameter10"/>
 </meanParameter>
 <coefficientOfVariation>
   <designMatrix idref="designMatrix10"/>
 </coefficientOfVariation>
 <data>
   <compoundParameter idref="compoundParameter4"/>
   <compoundParameter idref="compoundParameter6"/>
   <duplicatedParameter idref="duplicatedParameter4"/>
 </data>
</multivariateGammaPrior>


<multivariateInverseWishartPrior> element

Calculates the likelihood of some data under an Inverse-Wishart distribution.


The element takes following attributes:


The element has the following contents:

  • Element named <scaleMatrix> containing:


Example:

<multivariateInverseWishartPrior df="1.0">
 <scaleMatrix>
   <diagonalMatrix idref="diagonalMatrix9"/>
 </scaleMatrix>
</multivariateInverseWishartPrior>


<multivariateNormalPrior> element

Calculates the likelihood of some data under a given multivariate-normal distribution.


The element has the following contents:

  • Element named <meanParameter> containing:
  • Element named <precisionParameter> containing:
  • Element named <data> containing:


Example:

<multivariateNormalPrior>
 <meanParameter>
   <maskedParameter idref="maskedParameter1"/>
 </meanParameter>
 <precisionParameter>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix4"/>
 </precisionParameter>
</multivariateNormalPrior>


<multivariateOUModel> element

Describes a multivariate OU process


The element has the following contents:


Example:

<multivariateOUModel>
  <substitutionEpochModel idref="substitutionEpochModel2"/>
  <diagonalMatrix idref="diagonalMatrix5"/>
 <data>
   <diagonalMatrix idref="diagonalMatrix5"/>
 </data>
 <times>
   <compoundParameter idref="compoundParameter6"/>
 </times>
 <design>
   <maskedParameter idref="maskedParameter4"/>
 </design>
</multivariateOUModel>


<multivariateTDiffusionModel> element

Describes a multivariate t-distribution diffusion process.


The element has the following contents:

  • Element named <precisionParameter> containing:
  • Element named <dfParameter> containing:


Example:

<multivariateTDiffusionModel>
 <precisionParameter>
   <designMatrix idref="designMatrix1"/>
 </precisionParameter>
 <dfParameter>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix6"/>
 </dfParameter>
</multivariateTDiffusionModel>


<multivariateTraitLikelihood> element

Provides the likelihood of a continuous trait evolving on a tree by a given diffusion model.


The element takes following attributes:

  • Attribute traitName is String
    The name of the trait for which a likelihood should be calculated
  • Attribute (optional) integrateInternalTraits is Boolean
  • Attribute (optional) cut is Double;
  • Attribute (optional) reportAsMultivariate is Boolean
  • Attribute (optional) useTreeLength is Boolean
  • Attribute (optional) scaleByTime is Boolean
  • Attribute (optional) reciprocalRates is Boolean
  • Attribute (optional) randomSample is Integer


The element has the following contents:


Example:

<multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" randomSample="1">
 <traitParameter>
   <compoundParameter idref="compoundParameter6"/>
 </traitParameter>
  <greatCircleDiffusionModel idref="greatCircleDiffusionModel5"/>
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/>
</multivariateTraitLikelihood>


<multivariateWishartPrior> element

Calculates the likelihood of some data under a Wishart distribution.


The element takes following attributes:

  • Attribute (optional) nonInformative is Boolean
  • Attribute (optional) df is Integer


The element has the following contents:

  • Element named <scaleMatrix> containing:
  • Element named <data> containing:


Example:

<multivariateWishartPrior nonInformative="true" df="1">
 <data>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix5"/>
   <matrixParameter idref="matrixParameter5"/>
 </data>
</multivariateWishartPrior>


<MutationDeathModel> element

This element represents an instance of the MutationDeath model of CTMC evolution with deletions.


The element has the following contents:


Example:

<MutationDeathModel>
  <designMatrix idref="designMatrix10"/>
  <extendedDataType idref="extendedDataType9"/>
</MutationDeathModel>


<mvouOperator> element

This element returns junk.


The element takes following attributes:

  • Attribute mixingFactor is Double
  • Attribute priorDf is Integer
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<mvouOperator mixingFactor="1.0" priorDf="1" weight="1.0" autoOptimize="true">
  <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/>
</mvouOperator>


<narrowExchange> element

This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.


The element takes following attributes:


The element has the following contents:


Example:

<narrowExchange weight="1.0">
  <treeModel idref="treeModel4"/>
</narrowExchange>


<NearestNeighborInterchange> element

This element represents a NNI operator. This operator swaps a random subtree with its uncle.


The element takes following attributes:


The element has the following contents:


Example:

<NearestNeighborInterchange weight="1.0">
  <treeModel idref="treeModel9"/>
</NearestNeighborInterchange>


<negativeStatistic> element

This element returns a statistic that is the element-wise negation of the child statistic.


The element has the following contents:


Example:

<negativeStatistic>
  <argReassortmentNodeCount idref="argReassortmentNodeCount2"/>
</negativeStatistic>


<negativeStatistic> element

This element returns a statistic that is the element-wise negation of the child statistic.


The element has the following contents:


Example:

<negativeStatistic>
  <externalLengthStatistic idref="externalLengthStatistic3"/>
</negativeStatistic>


<negativeStatistic> element

This element returns a statistic that is the element-wise negation of the child statistic.


The element has the following contents:


Example:

<negativeStatistic>
  <argTotalLengthStatistic idref="argTotalLengthStatistic4"/>
</negativeStatistic>


<neighborJoiningTree> element

This element returns a neighbour-joining tree generated from the given distances.


The element has the following contents:


Example:

<neighborJoiningTree>
  <distanceMatrix idref="distanceMatrix5"/>
</neighborJoiningTree>


<newARGEvent> element

An operator that slides a subarg.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute size is Double
  • Attribute gaussian is Boolean
  • Attribute (optional) swapRates is Boolean
  • Attribute (optional) swapTraits is Boolean
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<newARGEvent weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
  <argTreeModel idref="argTreeModel9"/>
</newARGEvent>


<newick> element

Constructs a tree from a NEWICK format tree description


The element takes following attributes:

  • Attribute (optional) usingDates is Boolean
  • Attribute (optional) rescaleHeight is Double
    Attempt to rescale the tree to the given root height
  • Attribute (optional) rescaleLength is Double
    Attempt to rescale the tree to the given total length
  • Attribute (optional) units is String
    The branch length units of this tree


The element has the following contents:

  • String element (exactly one)
    The NEWICK format tree. Tip labels are taken to be Taxon IDs


Example:

<newick units="years"> ((A:1.0, B:1.0):1.0,(C:2.0, D:2.0):1.0); </newick>


<node> element

This element represents a node in a tree.


The element takes following attributes:

  • Attribute (optional) height is Double
    the age of the node
  • Attribute (optional) rate is Double
    the relative rate of evolution at this node - default is 1.0


The element has the following contents:

  • One of:
    • Taxon element (exactly one)
      The taxon of this leaf node
    • SimpleNode elements (exactly 2)
      The children of this internal node


Example:

<node height="1.0" rate="1.0">
  <node idref="node7"/>
  <node idref="node3"/>
</node>


<nodeHeightsStatistic> element

A statistic that returns the heights of each internal node in increasing order (or groups them by a group size parameter)


The element takes following attributes:

  • Attribute (optional) name is String


The element has the following contents:


Example:

<nodeHeightsStatistic name="foo">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1"/>
</nodeHeightsStatistic>


<nodePosteriorLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) allowMissingTaxa is Boolean


The element has the following contents:


Example:

<nodePosteriorLikelihood useAmbiguities="true" allowMissingTaxa="true">
  <convert idref="convert4"/>
  <treeModel idref="treeModel3"/>
  <siteModel idref="siteModel7"/>
  <covarionModel idref="covarionModel10"/>
</nodePosteriorLikelihood>


<nodeReHeight> element

Specialized Species tree operator, transform tree without breaking embedding of gene trees.


The element takes following attributes:


The element has the following contents:


Example:

<nodeReHeight weight="1.0">
  <species idref="species1"/>
  <speciesTree idref="speciesTree3"/>
</nodeReHeight>


<normalDistributionModel> element

Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element


The element has the following contents:

  • Element named <mean> containing:
  • One of:
    • Element named <stdev> containing:
    • Element named <precision> containing:


Example:

<normalDistributionModel>
 <mean>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix10"/>
 </mean>
 <stdev>
   1.0
 </stdev>
</normalDistributionModel>


<normalGammaPrecisionGibbsOperator> element

This element returns a operator on the precision parameter of a normal model with gamma prior.


The element takes following attributes:


The element has the following contents:


Example:

<normalGammaPrecisionGibbsOperator weight="1.0">
 <likelihood>
   <cachedPrior idref="cachedPrior3"/>
 </likelihood>
 <prior>
   <distributionLikelihood idref="distributionLikelihood8"/>
 </prior>
</normalGammaPrecisionGibbsOperator>


<normalNormalMeanGibbsOperator> element

This element returns a operator on the mean parameter of a normal model with normal prior.


The element takes following attributes:


The element has the following contents:


Example:

<normalNormalMeanGibbsOperator weight="1.0">
 <likelihood>
   <twoPartDistribution idref="twoPartDistribution10"/>
 </likelihood>
 <prior>
   <twoPartDistribution idref="twoPartDistribution6"/>
 </prior>
</normalNormalMeanGibbsOperator>


<normalPrior> element

Calculates the prior probability of some data under a given normal distribution.


The element takes following attributes:


The element has the following contents:


Example:

<normalPrior mean="1.0" stdev="1.0">
  <logarithmStatistic idref="logarithmStatistic8"/>
  <rateCovarianceStatistic idref="rateCovarianceStatistic8"/>
  <monotonicStatistic idref="monotonicStatistic6"/>
  <argTotalLengthStatistic idref="argTotalLengthStatistic1"/>
</normalPrior>


<notStatistic> element

This element returns a statistic that is the element-wise inverse of the child statistic.


The element has the following contents:


Example:

<notStatistic>
  <argReassortmentNodeCount idref="argReassortmentNodeCount5"/>
</notStatistic>


<notStatistic> element

This element returns a statistic that is the element-wise inverse of the child statistic.


The element has the following contents:


Example:

<notStatistic>
  <argReassortmentNodeCount idref="argReassortmentNodeCount9"/>
</notStatistic>


<oneOnXPrior> element

Calculates the (improper) prior proportional to Prod_i (1/x_i) for the given statistic x.


The element has the following contents:

  • One of:
    • Statistic elements (one or more)
    • Element named <data> containing:


Example:

<oneOnXPrior>
  <argTreeCount idref="argTreeCount6"/>
  <treeShapeStatistics idref="treeShapeStatistics5"/>
</oneOnXPrior>


<onePGammaDistributionModel> element

A model of a one parameter gamma distribution.


The element has the following contents:

  • One of:
    • Element named <shape> containing:
    • Element named <shape> containing:


Example:

<onePGammaDistributionModel>
 <shape>
   <designMatrix idref="designMatrix5"/>
 </shape>
</onePGammaDistributionModel>


<operators> element

A simple operator scheduler


The element takes following attributes:

  • Attribute (optional) sequential is Boolean
  • Attribute (optional) optimizationSchedule is String


The element has the following contents:


Example:

<operators sequential="true" optimizationSchedule="foo">
  <argSwapOperator idref="argSwapOperator8"/>
</operators>


<optimizer> element

This element returns a maximum likelihood heuristic optimizer and runs the optimization as a side effect.


The element takes following attributes:


The element has the following contents:


Example:

<optimizer chainLength="1">
  <operators idref="operators7"/>
  <speciesCoalescent idref="speciesCoalescent4"/>
  <logArgTree idref="logArgTree6"/>
  <logArg idref="logArg2"/>
  <logML idref="logML6"/>
</optimizer>


<Ornstein-Uhlenbeck> element

The element takes following attributes:

  • Attribute (optional) logUnits is Boolean
  • Attribute (optional) normalize is Boolean


The element has the following contents:

  • One of:
    • Element named <mean> containing:
    • Element named <mean> containing:
  • One of:
    • Element named <sigma> containing:
    • Element named <sigma> containing:
  • One of:
    • Element named <lambda> containing:
    • Element named <lambda> containing:


Example:

<Ornstein-Uhlenbeck logUnits="true" normalize="true">
 <mean>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix9"/>
 </mean>
 <sigma>
   1.0
 </sigma>
 <lambda>
   1.0
 </lambda>
</Ornstein-Uhlenbeck>


<ovariableSkyLineLikelihood> element

This element represents the likelihood of the tree given the population size vector.


The element takes following attributes:


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <indicators> containing:
  • Element named <populationTree> containing:


Example:

<ovariableSkyLineLikelihood type="true" logUnits="true">
 <populationSizes>
   <maskedParameter idref="maskedParameter1"/>
 </populationSizes>
 <indicators>
   <designMatrix idref="designMatrix4"/>
 </indicators>
 <populationTree>
   <treeModel idref="treeModel10"/>
 </populationTree>
</ovariableSkyLineLikelihood>


<parameter> element

A real-valued parameter of one or more dimensions.


The element takes following attributes:

  • Attribute (optional) value is Double;
  • Attribute (optional) dimension is Integer
  • Attribute (optional) upper is Double;
  • Attribute (optional) lower is Double;


The element has the following contents:

  • Element named <randomize> containing:


Example:

<parameter value="0.5 1.0" dimension="1" upper="0.5 1.0" lower="0.5 1.0"/>


<parsimonyStateStatistic> element

A statistic that has as its value the parsimony state reconstruction of a binary state defined by a set of taxa at a given MRCA of a tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic for the purposes of logging


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <state> containing:
    • Taxa element (exactly one)
  • Element named <mrca> containing:
    • Taxa element (exactly one)


Example:

<parsimonyStateStatistic name="foo">
  <treeModel idref="treeModel6"/>
 <state>
   <taxa idref="taxa5"/>
 </state>
 <mrca>
   <taxa idref="taxa8"/>
 </mrca>
</parsimonyStateStatistic>


<parsimonyStatistic> element

A statistic that has as its value the parsimony tree length of a set of a binary state defined by a set of taxa for a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <state> containing:
    • Taxa element (exactly one)


Example:

<parsimonyStatistic name="foo">
  <treeModel idref="treeModel8"/>
 <state>
   <taxa idref="taxa2"/>
 </state>
</parsimonyStatistic>


<partitionStatistic> element

null


Example:

<partitionStatistic/>


<patterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.


The element takes following attributes:

  • Attribute (optional) from is Integer
    The site position to start at, default is 1 (the first position)
  • Attribute (optional) to is Integer
    The site position to finish at, must be greater than from, default is length of given alignment
  • Attribute (optional) every is Integer
    Determines how many sites are selected. A value of 3 will select every third site starting from from, default is 1 (every site)
  • Attribute (optional) strip is Boolean
    Strip out completely ambiguous sites
  • Attribute (optional) unique is Boolean
    Return a weight list of unique patterns


The element has the following contents:

  • Element named <taxonList> containing:
  • Alignment element (exactly one)


Example:

<patterns from="1" to="1" every="1" strip="true" unique="true">
  <hypermutantAlignment idref="hypermutantAlignment7"/>
</patterns>


<patternSubSet> element

A weighted list of the unique site patterns (unique columns) in an alignment.


The element takes following attributes:

  • Attribute (optional) subSet is Integer
    Which subset of patterns to use (out of subSetCount)
  • Attribute (optional) subSetCount is Integer
    The number of subsets


The element has the following contents:


Example:

<patternSubSet subSet="1" subSetCount="1">
  <alignment idref="alignment10"/>
</patternSubSet>


<piecewisePopulation> element

This element represents a piecewise population model


The element takes following attributes:

  • Attribute (optional) linear is Boolean


The element has the following contents:

  • One of:
    • Element named <epochSizes> containing:
    • All of:***Element named <populationSize> containing:
      • Element named <growthRates> containing:


  • Element named <epochWidths> containing:


Example:

<piecewisePopulation linear="true">
 <epochSizes>
   <parameter idref="parameter2"/>
 </epochSizes>
 <epochWidths widths="0.5 1.0"/>
</piecewisePopulation>


<poissonPartitionLikelihood> element

null


The element takes following attributes:


The element has the following contents:


Example:

<poissonPartitionLikelihood mean="1.0">
  <argTreeModel idref="argTreeModel6"/>
</poissonPartitionLikelihood>


<poissonPrior> element

Calculates the prior probability of some data under a given poisson distribution.


The element takes following attributes:


The element has the following contents:


Example:

<poissonPrior mean="1.0" offset="1.0">
  <generalizedSkylinePopSizeStatistic idref="generalizedSkylinePopSizeStatistic8"/>
  <loggableStatistic idref="loggableStatistic4"/>
</poissonPrior>


<polygon> element

This element represents a polygon.


The element takes following attributes:

  • Attribute (optional) closed is Boolean
  • Attribute (optional) fillValue is Double


The element has the following contents:


Example:

<polygon closed="true" fillValue="1.0">
  <polygon idref="polygon1"/>
</polygon>


<poolSwapOperator> element

.


The element takes following attributes:


The element has the following contents:


Example:

<poolSwapOperator weight="1.0">
  ERROR!
</poolSwapOperator>


<popGraph> element

This element returns a statistic that is the population size at evenly spaced intervals over tree.


The element takes following attributes:


The element has the following contents:


Example:

<popGraph time="1.0">
  <variableDemographic idref="variableDemographic9"/>
</popGraph>


<positiveDefiniteSubstitutionModel> element

A general reversible model of sequence substitution for any data type with stochastic variable selection.


The element has the following contents:


Example:

<positiveDefiniteSubstitutionModel>
  <designMatrix idref="designMatrix7"/>
</positiveDefiniteSubstitutionModel>


<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) threads is Integer


The element has the following contents:


Example:

<compoundLikelihood threads="1">
  <booleanLikelihood idref="booleanLikelihood5"/>
  <ancestralTreeLikelihood idref="ancestralTreeLikelihood2"/>
</compoundLikelihood>


<precisionGibbsOperator> element

This element returns a multivariate normal random walk operator on a given parameter.


The element takes following attributes:


The element has the following contents:


Example:

<precisionGibbsOperator weight="1.0">
  <multivariateTraitLikelihood idref="multivariateTraitLikelihood4"/>
  <multivariateNormalPrior idref="multivariateNormalPrior10"/>
</precisionGibbsOperator>


<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) threads is Integer


The element has the following contents:


Example:

<compoundLikelihood threads="1">
  <ancestralTreeLikelihood idref="ancestralTreeLikelihood1"/>
  <UCLikelihood idref="UCLikelihood6"/>
  <UCLikelihood idref="UCLikelihood4"/>
</compoundLikelihood>


<productStatistic> element

This element returns a statistic that is the product of the child statistics.


The element takes following attributes:

  • Attribute (optional) elementwise is Boolean


The element has the following contents:


Example:

<productStatistic elementwise="true">
  <rateStatistic idref="rateStatistic4"/>
</productStatistic>


<productStatistic> element

This element returns a statistic that is the product of the child statistics.


The element takes following attributes:

  • Attribute (optional) elementwise is Boolean


The element has the following contents:


Example:

<productStatistic elementwise="true">
  <differenceStatistic idref="differenceStatistic5"/>
  <reciprocalStatistic idref="reciprocalStatistic6"/>
  <matrixParameter idref="matrixParameter8"/>
</productStatistic>


<property> element

This element returns an object representing the named property of the given child object.


The element takes following attributes:

  • Attribute name is String
    name of the property


The element has the following contents:


Example:

<property name="length">
  <uniformPartitionLikelihood idref="uniformPartitionLikelihood1"/>
</property>


<randomDiscretizedBranchRates> element

This element returns a random discretized relaxed clock model.The branch rates are drawn from a continuous parametric distribution.


The element takes following attributes:

  • Attribute (optional) singleRootRate is Boolean
    Whether only a single rate should be used for the two children branches of the root
  • Attribute (optional) normalize is Boolean
    Whether the mean rate has to be normalized to a particular value
  • Attribute (optional) normalizeBranchRateTo is Double
    The mean rate to normalize to, if normalizing


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <distribution> containing:
  • Element named <rateCategoryQuantiles> containing:
    • Parameter element (exactly one)
      The quantiles for


Example:

<randomDiscretizedBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0">
  <treeModel idref="treeModel9"/>
 <distribution>
   <inverseGaussianDistributionModel idref="inverseGaussianDistributionModel2"/>
 </distribution>
 <rateCategoryQuantiles>
   <parameter idref="parameter2"/>
 </rateCategoryQuantiles>
</randomDiscretizedBranchRates>


<randomLocalClockModel> element

This element returns an random local clock (RLC) model.Each branch either has a new rate or inherits the rate of the branch above it depending on the indicator vector, which is itself sampled.


The element takes following attributes:

  • Attribute ratesAreMultipliers is Boolean


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rateIndicator> containing:
    • Parameter element (exactly one)
      The rate change indicators parameter
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The rates parameter
  • Element named <clockRate> containing:
    • Parameter element (exactly one)
      The mean rate across all local clocks


Example:

<randomLocalClockModel ratesAreMultipliers="true">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3"/>
 <rateIndicator>
   <designMatrix idref="designMatrix7"/>
 </rateIndicator>
 <rates>
   <duplicatedParameter idref="duplicatedParameter9"/>
 </rates>
</randomLocalClockModel>


<randomLocalLogger> element

A speciation model of a Yule process whose rate can evolve down the tree.


The element takes following attributes:


The element has the following contents:


Example:

<randomLocalLogger logEvery="1" fileName="foo">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3"/>
  <randomLocalClockModel idref="randomLocalClockModel1"/>
</randomLocalLogger>


<randomLocalYuleModel> element

A speciation model of a Yule process whose rate can change at random nodes in the tree.


The element takes following attributes:

  • Attribute ratesAsMultipliers is Boolean
  • Attribute (optional) dp is Integer
  • Attribute units is String
    the units


The element has the following contents:

  • Element named <birthRates> containing:
  • Element named <indicators> containing:
  • Element named <meanRate> containing:


Example:

<randomLocalYuleModel ratesAsMultipliers="true" dp="1" units="days">
 <birthRates>
   <maskedParameter idref="maskedParameter1"/>
 </birthRates>
 <indicators>
   <maskedParameter idref="maskedParameter9"/>
 </indicators>
 <meanRate>
   <matrixParameter idref="matrixParameter10"/>
 </meanRate>
</randomLocalYuleModel>


<randomTaxaSample> element

Randomly samples n taxa from a collection of N taxa


The element takes following attributes:


The element has the following contents:

  • Taxa element (exactly one)


Example:

<randomTaxaSample sample="1">
  <taxa idref="taxa5"/>
</randomTaxaSample>


<randomWalk> element

Describes a first-order random walk. No prior is assumed on the first data element


The element takes following attributes:

  • Attribute (optional) logScale is Boolean


The element has the following contents:


Example:

<randomWalk logScale="true">
  <maskedParameter idref="maskedParameter6"/>
  <normalDistributionModel idref="normalDistributionModel7"/>
</randomWalk>


<randomWalkIntegerNodeHeightWeightedOperator> element

This element returns a random walk node height weighted operator on a given parameter.


The element takes following attributes:


The element has the following contents:

  • Parameter element (exactly one)
  • Element named <internalNodeHeights> containing:


Example:

<randomWalkIntegerNodeHeightWeightedOperator windowSize="1.0" weight="1.0">
  <parameter idref="parameter2"/>
 <internalNodeHeights>
   <duplicatedParameter idref="duplicatedParameter2"/>
 </internalNodeHeights>
</randomWalkIntegerNodeHeightWeightedOperator>


<randomWalkIntegerOperator> element

This element returns a random walk operator on a given parameter.


The element takes following attributes:


The element has the following contents:


Example:

<randomWalkIntegerOperator windowSize="1.0" weight="1.0">
  <parameter idref="parameter10"/>
</randomWalkIntegerOperator>


<randomWalkIntegerSetSizeWeightedOperator> element

This element returns a random walk set size weighted operator on a given parameter.


The element takes following attributes:

  • Attribute windowSize is Double
  • Attribute weight is Double
  • Attribute baseSetSize is Double


The element has the following contents:


Example:

<randomWalkIntegerSetSizeWeightedOperator windowSize="1.0" weight="1.0" baseSetSize="1.0">
  <maskedParameter idref="maskedParameter7"/>
  <microsatelliteSamplerTreeModel idref="microsatelliteSamplerTreeModel5"/>
</randomWalkIntegerSetSizeWeightedOperator>


<randomWalkOnMapOperator> element

This element returns a random walk operator on a given map.


The element takes following attributes:

  • Attribute windowSize is Double
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<randomWalkOnMapOperator windowSize="1.0" weight="1.0" autoOptimize="true">
  ERROR!
  <compoundParameter idref="compoundParameter2"/>
</randomWalkOnMapOperator>


<randomWalkOperator> element

This element returns a random walk operator on a given parameter.


The element takes following attributes:

  • Attribute windowSize is Double
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) boundaryCondition is String


The element has the following contents:


Example:

<randomWalkOperator windowSize="1.0" weight="1.0" autoOptimize="true" boundaryCondition="reflecting">
  <diagonalMatrix idref="diagonalMatrix7"/>
</randomWalkOperator>


<rateBitExchangeOperator> element

This element returns a bit-flip operator on a given parameter.


The element takes following attributes:


The element has the following contents:

  • Element named <bits> containing:
  • Element named <rates> containing:


Example:

<rateBitExchangeOperator weight="1.0">
 <bits>
   <diagonalMatrix idref="diagonalMatrix10"/>
 </bits>
 <rates>
   <matrixParameter idref="matrixParameter3"/>
 </rates>
</rateBitExchangeOperator>


<rateCovarianceStatistic> element

A statistic that has as its value the covariance of parent and child branch rates


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:


Example:

<rateCovarianceStatistic name="foo">
  <treeModel idref="treeModel5"/>
  <rateEpochBranchRates idref="rateEpochBranchRates7"/>
</rateCovarianceStatistic>


<rateEpochBranchRates> element

This element provides a multiple epoch molecular clock model. All branches (or portions of them) have the same rate of molecular evolution within a given epoch. If parameters are used to sample transition times, these must be kept in ascending order by judicious use of bounds or priors.


The element takes following attributes:

  • Attribute (optional) continuousNormalization is Boolean
    Special rate normalization for a Brownian diffusion process


The element has the following contents:

  • Element named <epoch> containing:
    • Attribute (optional) transitionTime is Double
      The time of transition between this epoch and the previous one
    • Parameter element (exactly one)
      The evolutionary rate parameter for this epoch
    • Element named <transitionTime> containing:
      • Parameter element (exactly one)
        The transition time parameter for this epoch
      An epoch that lasts until transitionTime
  • Element named <rate> containing:
    • Parameter element (exactly one)
      The ancestral molecular evolutionary rate parameter
  • Element named <rootHeight> containing:
    • Parameter element (exactly one)
      The tree root height
      Parameterization may require the root height


Example:

<rateEpochBranchRates continuousNormalization="true">
 <epoch transitionTime="1.0">
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix5"/>
 </epoch>
 <rate>
   <duplicatedParameter idref="duplicatedParameter1"/>
 </rate>
</rateEpochBranchRates>


<rateExchange> element

An operator that exchanges rates and traits on a tree.


The element takes following attributes:


The element has the following contents:


Example:

<rateExchange weight="1.0" swapRates="true" swapTraits="true" swapAtRoot="true" moveHeight="true">
  <treeModel idref="treeModel6"/>
</rateExchange>


<rateSampleOperator> element

This element returns a rateSample operator on a given parameter.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) sampleAll is Boolean


The element has the following contents:


Example:

<rateSampleOperator weight="1.0" sampleAll="true">
  <treeModel idref="treeModel2"/>
</rateSampleOperator>


<rateScaleOperator> element

This element returns a rateScale operator on a given parameter.


The element takes following attributes:

  • Attribute scaleFactor is Double
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) noRoot is Boolean


The element has the following contents:


Example:

<rateScaleOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" noRoot="true">
  <treeModel idref="treeModel7"/>
</rateScaleOperator>


<rateStatistic> element

A statistic that returns the average of the branch rates


The element takes following attributes:

  • Attribute internal is Boolean
  • Attribute external is Boolean
  • Attribute mode is String
    This attribute determines how the rates are summarized, can be one of (mean, variance, coefficientOfVariance)
  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:


Example:

<rateStatistic internal="true" external="true" mode="coefficientOfVariation" name="foo">
  <treeModel idref="treeModel8"/>
  <strictClockBranchRates idref="strictClockBranchRates1"/>
</rateStatistic>


<rateVarianceScaleOperator> element

This element returns a rateScale operator on a given parameter.


The element takes following attributes:

  • Attribute scaleFactor is Double
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<rateVarianceScaleOperator scaleFactor="1.0" weight="1.0" autoOptimize="true">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2"/>
  <duplicatedParameter idref="duplicatedParameter1"/>
</rateVarianceScaleOperator>


<ratioStatistic> element

This element returns a statistic that is the ratio of the 2 child statistics.


The element has the following contents:

  • Statistic elements (exactly 2)
    The two operand statistics


Example:

<ratioStatistic>
  <argTimingStatistic idref="argTimingStatistic3"/>
  <generalizedSkylinePopSizeStatistic idref="generalizedSkylinePopSizeStatistic4"/>
</ratioStatistic>


<ratioStatistic> element

This element returns a statistic that is the ratio of the 2 child statistics.


The element has the following contents:

  • Statistic elements (exactly 2)
    The two operand statistics


Example:

<ratioStatistic>
  <externalLengthStatistic idref="externalLengthStatistic7"/>
  <varianceStatistic idref="varianceStatistic4"/>
</ratioStatistic>


<reciprocalStatistic> element

This element returns a statistic that is the element-wise reciprocal of the child statistic.


The element has the following contents:


Example:

<reciprocalStatistic>
  <statistic idref="statistic8"/>
</reciprocalStatistic>


<reciprocalStatistic> element

This element returns a statistic that is the element-wise reciprocal of the child statistic.


The element has the following contents:


Example:

<reciprocalStatistic>
  <negativeStatistic idref="negativeStatistic7"/>
</reciprocalStatistic>


<regressionGibbsEffectOperator> element

This element returns a multivariate Gibbs operator on an internal node trait.


The element takes following attributes:


The element has the following contents:


Example:

<regressionGibbsEffectOperator weight="1.0">
  <maskedParameter idref="maskedParameter5"/>
  <multivariateGammaPrior idref="multivariateGammaPrior3"/>
  ERROR!
</regressionGibbsEffectOperator>


<regressionGibbsPrecisionOperator> element

This element returns a multivariate Gibbs operator on an internal node trait.


The element takes following attributes:


The element has the following contents:


Example:

<regressionGibbsPrecisionOperator weight="1.0">
  <compoundParameter idref="compoundParameter6"/>
  <cachedPrior idref="cachedPrior5"/>
  ERROR!
</regressionGibbsPrecisionOperator>


<regressionMetropolizedIndicatorOperator> element

This element returns a multivariate Gibbs operator on an internal node trait.


The element takes following attributes:


The element has the following contents:


Example:

<regressionMetropolizedIndicatorOperator weight="1.0">
  <compoundParameter idref="compoundParameter7"/>
  <multivariateNormalPrior idref="multivariateNormalPrior3"/>
  ERROR!
 <indicator>
   <duplicatedParameter idref="duplicatedParameter10"/>
 </indicator>
</regressionMetropolizedIndicatorOperator>


<report> element

Generates a report using the given text and elements


The element takes following attributes:

  • Attribute (optional) type is String
    The format of the report
  • Attribute (optional) title is String
    The title of the report
  • Attribute (optional) fileName is String


The element has the following contents:

  • Object elements (one or more)
    An arbitrary mixture of text and elements to report


Example:

<report type="XHTML" title="Report" fileName="foo">
  <randomWalkOnMapOperator idref="randomWalkOnMapOperator1"/>
  <argUniformPrior idref="argUniformPrior2"/>
  <NearestNeighborInterchange idref="NearestNeighborInterchange2"/>
</report>


<RPNcalculator> element

This element returns a statistic evaluated from arbitrary expression.


The element has the following contents:

  • Element named <expression> containing:
  • Element named <variable> containing:


Example:

<RPNcalculator>
 <expression>
   foo
 </expression>
 <variable>
   <parsimonyStatistic idref="parsimonyStatistic6"/>
 </variable>
 <variable>
   <logarithmStatistic idref="logarithmStatistic10"/>
 </variable>
 <variable>
   <RPNcalculator idref="RPNcalculator2"/>
 </variable>
</RPNcalculator>


<sampleNonActiveOperator> element

This element returns a Gibbs operator for the joint distribution of population sizes.


The element takes following attributes:


The element has the following contents:

  • Element named <distribution> containing:
  • Element named <indicators> containing:
  • Element named <data> containing:


Example:

<sampleNonActiveOperator weight="1.0">
 <distribution>
   <logNormalDistributionModel idref="logNormalDistributionModel8"/>
 </distribution>
 <indicators>
   <duplicatedParameter idref="duplicatedParameter6"/>
 </indicators>
 <data>
   <matrixParameter idref="matrixParameter3"/>
 </data>
</sampleNonActiveOperator>


<sampleStateAndCategoryModel> element

A SiteModel that has a discrete distribution of substitution models over sites, designed for sampling of rate categories and internal states.


The element has the following contents:

  • Element named <mutationRate> containing:
  • Element named <categoriesParameter> containing:
  • SubstitutionModel elements (one or more)


Example:

<sampleStateAndCategoryModel>
 <mutationRate>
   <parameter idref="parameter7"/>
 </mutationRate>
 <categoriesParameter>
   <maskedParameter idref="maskedParameter2"/>
 </categoriesParameter>
  <gtrModel idref="gtrModel4"/>
  <CovarionHKYModel idref="CovarionHKYModel3"/>
  <aminoAcidModel idref="aminoAcidModel2"/>
</sampleStateAndCategoryModel>


<sampleStateModel> element

A SiteModel that has a discrete distribution of substitution models over sites, designed for sampling of internal states.


The element has the following contents:

  • Element named <mutationRate> containing:
  • Element named <proportions> containing:
  • SubstitutionModel elements (one or more)


Example:

<sampleStateModel>
 <mutationRate>
   <matrixParameter idref="matrixParameter5"/>
 </mutationRate>
 <proportions>
   <matrixParameter idref="matrixParameter5"/>
 </proportions>
  <positiveDefiniteSubstitutionModel idref="positiveDefiniteSubstitutionModel8"/>
  <MutationDeathModel idref="MutationDeathModel4"/>
  <yangCodonModel idref="yangCodonModel3"/>
</sampleStateModel>


<scaledPiecewisePopulation> element

This element represents a piecewise population model


The element takes following attributes:


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <populationTree> containing:


Example:

<scaledPiecewisePopulation units="years" linear="true">
 <populationSizes>
   <diagonalMatrix idref="diagonalMatrix8"/>
 </populationSizes>
 <populationTree>
   <treeModel idref="treeModel10"/>
 </populationTree>
</scaledPiecewisePopulation>


<scaledTreeLengthModel> element

This element returns a branch rate model that scales the total length of the tree to specified valued (default=1.0).


The element has the following contents:

  • Element named <scalingFactor> containing:
  • TreeModel element (exactly one)


Example:

<scaledTreeLengthModel>
  <treeModel idref="treeModel7"/>
</scaledTreeLengthModel>


<scaleOperator> element

This element returns a scale operator on a given parameter.


The element takes following attributes:

  • Attribute scaleFactor is Double
  • Attribute (optional) scaleAll is Boolean
  • Attribute (optional) scaleAllIndependently is Boolean
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean
  • Attribute (optional) df is Integer


The element has the following contents:

  • Parameter element (exactly one)
  • Element named <indicators> containing:
    • Attribute (optional) pickoneprob is Double
    • Parameter element (exactly one)


Example:

<scaleOperator scaleFactor="1.0" scaleAll="true" scaleAllIndependently="true" weight="1.0" autoOptimize="true" df="1">
  <compoundParameter idref="compoundParameter4"/>
</scaleOperator>


<selectorOperator> element

.


The element takes following attributes:


The element has the following contents:


Example:

<selectorOperator weight="1.0">
  <matrixParameter idref="matrixParameter8"/>
</selectorOperator>


<sequence> element

A biomolecular sequence.


The element has the following contents:

  • Taxon element (exactly one)
  • String element (exactly one)
    A character string representing the aligned molecular sequence


Example:

<sequence>
  <taxon idref="taxon3"/>
  ACGACTAGCATCGAGCTTCG--GATAGCATGC
</sequence>


<sequenceErrorModel> element

This element returns a model that allows for post-mortem DNA damage.


The element takes following attributes:

  • Attribute (optional) type is String


The element has the following contents:

  • Element named <baseErrorRate> containing:
    • Parameter element (exactly one)
      The base error rate per site per sequence
  • Element named <ageRelatedErrorRate> containing:
    • Parameter element (exactly one)
      The error rate per site per unit time
  • Element named <indicators> containing:
    • Parameter element (exactly one)
      A binary indicator of whether the sequence has errors
  • One of:
    • Element named <include> containing:
      • TaxonList element (exactly one)
        A set of taxa to which to apply the damage model to
    • Element named <exclude> containing:
      • TaxonList element (exactly one)
        A set of taxa to which to not apply the damage model to


Example:

<sequenceErrorModel type="foo">
 <include>
   <patternSubSet idref="patternSubSet2"/>
 </include>
</sequenceErrorModel>


<sequenceSimulator> element

A SequenceSimulator that generates random sequences for a given tree, sitemodel and branch rate model


The element takes following attributes:


The element has the following contents:


Example:

<sequenceSimulator replications="1">
  <newick idref="newick10"/>
  <sampleStateModel idref="sampleStateModel3"/>
</sequenceSimulator>


<setOperator> element

This element represents an operator on a set.


The element takes following attributes:


The element has the following contents:


Example:

<setOperator set="0.5 1.0" weight="1.0">
  <compoundParameter idref="compoundParameter8"/>
</setOperator>


<singleTipObservationProcess> element

This element represents an instance of the SingleTipObservationProcess for ALSTreeLikelihood calculations


The element has the following contents:


Example:

<singleTipObservationProcess>
  <treeModel idref="treeModel3"/>
  <convert idref="convert10"/>
  <taxon idref="taxon2"/>
  <categorySiteModel idref="categorySiteModel6"/>
  <continuousTraitRateModel idref="continuousTraitRateModel5"/>
 <deathRate>
   <diagonalMatrix idref="diagonalMatrix1"/>
 </deathRate>
 <immigrationRate>
   <parameter idref="parameter4"/>
 </immigrationRate>
</singleTipObservationProcess>


<siteModel> element

A SiteModel that has a gamma distributed rates across sites


The element has the following contents:

  • Element named <substitutionModel> containing:
  • One of:
    • Element named <mutationRate> containing:
    • Element named <relativeRate> containing:
  • Element named <gammaShape> containing:
    • Attribute (optional) gammaCategories is Integer
    • Parameter element (exactly one)
  • Element named <proportionInvariant> containing:


Example:

<siteModel>
 <substitutionModel>
   <binarySubstitutionModel idref="binarySubstitutionModel2"/>
 </substitutionModel>
 <relativeRate>
   <designMatrix idref="designMatrix6"/>
 </relativeRate>
</siteModel>


<gmrfSkyrideLikelihood> element

This element represents the likelihood of the tree given the population size vector.


The element takes following attributes:

  • Attribute (optional) rescaleByRootHeight is Boolean
  • Attribute (optional) randomizeTree is Boolean
  • Attribute (optional) timeAwareSmoothing is Boolean


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <precisionParameter> containing:
  • Element named <populationTree> containing:
  • Element named <groupSizes> containing:


Example:

<gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true">
 <populationSizes>
   <parameter idref="parameter3"/>
 </populationSizes>
 <precisionParameter>
   <duplicatedParameter idref="duplicatedParameter6"/>
 </precisionParameter>
 <populationTree>
   <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel9"/>
   <treeModel idref="treeModel10"/>
 </populationTree>
</gmrfSkyrideLikelihood>


<slidingPatternsOperator> element

This element returns a sliding window operator on alignment sites.


The element takes following attributes:

  • Attribute windowSize is Integer
  • Attribute weight is Integer
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<slidingPatternsOperator windowSize="1" weight="1" autoOptimize="true">
 <breakPoints>
   <diagonalMatrix idref="diagonalMatrix5"/>
 </breakPoints>
  ERROR!
  ERROR!
</slidingPatternsOperator>


<sp> element

Taxon in a species tree


The element has the following contents:

  • Taxon elements (one or more)


Example:

<sp>
  <taxon idref="taxon10"/>
  <sp idref="sp8"/>
  <taxon idref="taxon4"/>
  <taxon idref="taxon2"/>
</sp>


<speciationLikelihood> element

This element represents the likelihood of the tree given the speciation.


The element has the following contents:

  • Element named <model> containing:
  • Element named <speciesTree> containing:
    • Tree element (exactly one)
  • Element named <include> containing:
    • Taxa elements (one or more)
      One or more subsets of taxa which should be included from calculate the likelihood (the remaining taxa are excluded)
  • Element named <exclude> containing:
    • Taxa elements (one or more)
      One or more subsets of taxa which should be excluded from calculate the likelihood (which is calculated on the remaining subtree)


Example:

<speciationLikelihood>
 <model>
   <yuleModel idref="yuleModel4"/>
 </model>
 <speciesTree>
   <neighborJoiningTree idref="neighborJoiningTree3"/>
 </speciesTree>
</speciationLikelihood>


<species> element

Binds taxa in gene trees with species information.


The element has the following contents:


Example:

<species>
  <sp idref="sp7"/>
  <sp idref="sp1"/>
  <sp idref="sp4"/>
  <sp idref="sp1"/>
 <geneTrees>
   <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5"/>
   <treeModel idref="treeModel3"/>
   <treeModel idref="treeModel10"/>
   <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8"/>
  <gtree ploidy="1.0">
    <treeModel idref="treeModel6"/>
  </gtree>
  <gtree ploidy="1.0">
    <treeModel idref="treeModel7"/>
  </gtree>
  <gtree ploidy="1.0">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1"/>
  </gtree>
  <gtree ploidy="1.0">
    <treeModel idref="treeModel6"/>
  </gtree>
 </geneTrees>
</species>


<speciesCoalescent> element

Compute coalecent log-liklihood of a set of gene trees embedded inside one species tree.


The element has the following contents:


Example:

<speciesCoalescent>
  <species idref="species2"/>
  <speciesTree idref="speciesTree8"/>
</speciesCoalescent>


<speciesTree> element

Species tree which includes demographic function per branch.


The element takes following attributes:

  • Attribute (optional) bmPrior is Boolean
  • Attribute (optional) constantRoot is Boolean
  • Attribute (optional) constantPopulation is Boolean


The element has the following contents:

  • SpeciesBindings element (exactly one)
  • Tree element (zero or one)
  • Element named <sppSplitPopulations> containing:
  • Element named <coalescentPointsPopulations> containing:
  • Element named <coalescentPointsIndicators> containing:


Example:

<speciesTree bmPrior="true" constantRoot="true" constantPopulation="true">
  <species idref="species1"/>
 <sppSplitPopulations value="1.0">
   <diagonalMatrix idref="diagonalMatrix10"/>
 </sppSplitPopulations>
</speciesTree>


<speciesTreePopulationPrior> element

The element has the following contents:


Example:

<speciesTreePopulationPrior>
  <speciesTree idref="speciesTree1"/>
 <tipsDistribution>
   <normalDistributionModel idref="normalDistributionModel3"/>
 </tipsDistribution>
 <sigma>
   <designMatrix idref="designMatrix3"/>
 </sigma>
</speciesTreePopulationPrior>


<speciesTreeStatistic> element

A statistic that returns true if the given population tree is compatible with the species tree. Compatibility is defined as the compatibility of the timings of the events, so that incompatibility arises if two individuals in the population tree coalescent before their species do in the species tree.


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:

  • Element named <speciesTree> containing:
    • Tree element (exactly one)
  • Element named <populationTree> containing:
    • Tree element (exactly one)


Example:

<speciesTreeStatistic name="foo">
 <speciesTree>
   <argTreeModel idref="argTreeModel3"/>
 </speciesTree>
 <populationTree>
   <neighborJoiningTree idref="neighborJoiningTree2"/>
 </populationTree>
</speciesTreeStatistic>


<statistic> element

A statistic of a given name from the specified object.


The element takes following attributes:

  • Attribute name is String
    The name of the statistic you wish to extract from the given object


The element has the following contents:


Example:

<statistic name="foo">
  <expConstExp idref="expConstExp4"/>
</statistic>


<STPopulationPrior> element

The element takes following attributes:

  • Attribute (optional) log_root is Boolean


The element has the following contents:


Example:

<STPopulationPrior log_root="true">
  <speciesTree idref="speciesTree3"/>
 <tipsDistribution>
   <normalDistributionModel idref="normalDistributionModel2"/>
 </tipsDistribution>
 <STsigma>
   <duplicatedParameter idref="duplicatedParameter9"/>
 </STsigma>
</STPopulationPrior>


<strictClockBranchRates> element

This element provides a strict clock model. All branches have the same rate of molecular evolution.


The element has the following contents:

  • Element named <rate> containing:
    • Parameter element (exactly one)
      The molecular evolutionary rate parameter


Example:

<strictClockBranchRates>
 <rate>
   <parameter idref="parameter2"/>
 </rate>
</strictClockBranchRates>


<string> element

returns a String. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned.


The element has the following contents:

  • One of:
    • Attribute prompt is String
      A message displayed to the user when entering a value for this string
    • String element (exactly one)


Example:

<string prompt="Enter the name of a dinosaur:"/>


<subStatistic> element

Allows you to choose specific dimensions of a given statistic


The element takes following attributes:


The element has the following contents:


Example:

<subStatistic dimension="1 2 4 8">
  <lineageCountStatistic idref="lineageCountStatistic9"/>
</subStatistic>


<substitutionEpochModel> element

null


The element has the following contents:


Example:

<substitutionEpochModel>
 <models>
   <CovarionHKYModel idref="CovarionHKYModel8"/>
   <covarionModel idref="covarionModel3"/>
   <TWOPHASEModel idref="TWOPHASEModel6"/>
   <msatAvgSubsetModel idref="msatAvgSubsetModel10"/>
 </models>
  <compoundParameter idref="compoundParameter9"/>
</substitutionEpochModel>


<subtreeSlide> element

An operator that slides a subtree.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) size is Double
  • Attribute (optional) targetAcceptance is Double
  • Attribute gaussian is Boolean
  • Attribute (optional) swapInRandomRate is Boolean
  • Attribute (optional) swapInRandomTrait is Boolean
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:


Example:

<subtreeSlide weight="1.0" size="1.0" targetAcceptance="1.0" gaussian="true" swapInRandomRate="true" swapInRandomTrait="true" autoOptimize="true">
  <treeModel idref="treeModel1"/>
</subtreeSlide>


<sumStatistic> element

This element returns a statistic that is the element-wise sum of the child statistics.


The element takes following attributes:

  • Attribute (optional) elementwise is Boolean


The element has the following contents:


Example:

<sumStatistic elementwise="true">
  <lineageCountStatistic idref="lineageCountStatistic2"/>
</sumStatistic>


<sumStatistic> element

This element returns a statistic that is the element-wise sum of the child statistics.


The element takes following attributes:

  • Attribute (optional) elementwise is Boolean


The element has the following contents:


Example:

<sumStatistic elementwise="true">
  <popGraph idref="popGraph9"/>
  <notStatistic idref="notStatistic9"/>
  <differenceStatistic idref="differenceStatistic4"/>
  <varianceStatistic idref="varianceStatistic4"/>
</sumStatistic>


<generalSubstitutionModel> element

A general reversible model of sequence substitution for any data type.


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <frequencies> containing:
  • Element named <rates> containing:
  • Element named <rateIndicator> containing:


Example:

<generalSubstitutionModel>
  <extendedDataType idref="extendedDataType3"/>
 <frequencies>
   <frequencyModel idref="frequencyModel1"/>
 </frequencies>
 <rates>
   <compoundParameter idref="compoundParameter1"/>
 </rates>
</generalSubstitutionModel>


<generalSubstitutionModel> element

A general reversible model of sequence substitution for any data type.


The element has the following contents:

  • One of:
    • Attribute dataType is String
      The type of sequence data
    • DataType element (exactly one)
  • Element named <frequencies> containing:
  • Element named <rates> containing:
  • Element named <rateIndicator> containing:


Example:

<generalSubstitutionModel>
  <hiddenNucleotides idref="hiddenNucleotides6"/>
 <frequencies>
   <frequencyModel idref="frequencyModel10"/>
 </frequencies>
 <rates>
   <diagonalMatrix idref="diagonalMatrix4"/>
 </rates>
</generalSubstitutionModel>


<swapOperator> element

This element represents an operator that swaps values in a multi-dimensional parameter.


The element takes following attributes:


The element has the following contents:


Example:

<swapOperator weight="1.0" size="1" autoOptimize="true">
  <matrixParameter idref="matrixParameter6"/>
</swapOperator>


<taxa> element

Defines a set of taxon objects.


The element has the following contents:

  • At least one of:**Taxa elements (one or more)
    • Taxon elements (one or more)


Example:

<!-- A list of six taxa -->
<taxa id="greatApes">
	<taxon id="human"/>
	<taxon id="chimp"/>
	<taxon id="bonobo"/>
	<taxon id="gorilla"/>
	<taxon id="orangutan"/>
	<taxon id="siamang"/>
</taxa>

<!-- A list of three taxa by references to above taxon objects -->
<taxa id="humanAndChimps">
	<taxon idref="human"/>
	<taxon idref="chimp"/>
	<taxon idref="bonobo"/>
</taxa>


<taxon> element

The element takes following attributes:

  • Attribute id is String
    A unique identifier for this taxon


The element has the following contents:


Example:

<taxon id="foo"/>


<teamOperator> element

An arbitrary list of operators; A random subset of size N is aggregated in one operation. Operators may have unequal weights - in that case a subset probability of selection is proportional to the sum of it's members weights.


The element takes following attributes:


The element has the following contents:


Example:

<teamOperator weight="1.0" size="1">
  <treeBitRandomWalk idref="treeBitRandomWalk2"/>
  <generalizedSkylineGibbsOperator idref="generalizedSkylineGibbsOperator8"/>
</teamOperator>


<test> element

This element represents a boolean statistic that returns 1 if the conditions are met and 0 otherwise.


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic, for logging purposes


The element has the following contents:

  • Attribute element (exactly one)
  • One of:
    • Element named <equals> containing:
    • Element named <greaterThan> containing:
    • Element named <lessThan> containing:
    • Attribute equals is Double
    • Attribute greaterThan is Double
    • Attribute lessThan is Double
    • Attribute inside is Double;
    • Attribute outside is Double;


Example:

<test name="foo">
  <parameter idref="parameter7"/>
 <lessThan>
   <attr idref="attr10"/>
 </lessThan>
</test>


<threadedCompoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.


The element takes following attributes:

  • Attribute (optional) robustWeight is Double


The element has the following contents:


Example:

<threadedCompoundLikelihood robustWeight="1.0">
  <invgammaPrior idref="invgammaPrior5"/>
  <normalPrior idref="normalPrior3"/>
  <speciationLikelihood idref="speciationLikelihood10"/>
  <multivariateGammaPrior idref="multivariateGammaPrior2"/>
</threadedCompoundLikelihood>


<tipHeightLikelihood> element

Calculates the likelihood of the tipHeights given some parametric or empirical distribution.


The element has the following contents:


Example:

<tipHeightLikelihood>
 <distribution>
   <inverseGaussianDistributionModel idref="inverseGaussianDistributionModel1"/>
 </distribution>
 <tipHeights>
   <compoundParameter idref="compoundParameter1"/>
 </tipHeights>
</tipHeightLikelihood>


<tipStateSwapOperator> element

This element represents an operator to swap tip states between two random tips.


The element takes following attributes:


The element has the following contents:


Example:

<tipStateSwapOperator weight="1.0">
  <ancestralTreeLikelihood idref="ancestralTreeLikelihood9"/>
</tipStateSwapOperator>


<tipTraitSwapOperator> element

This element represents an operator to swap tip traits between two random tips.


The element takes following attributes:


The element has the following contents:


Example:

<tipTraitSwapOperator trait="foo" weight="1.0">
  ERROR!
</tipTraitSwapOperator>


<tkf91Likelihood> element

Returns the total likelihood of a single alignment under the TKF91 model, for a given tree. In particular all possible ancestral histories of insertions and deletions leading to the alignment of sequences at the tips are taken into account.


The element has the following contents:


Example:

<tkf91Likelihood>
  <treeModel idref="treeModel10"/>
  <hypermutantAlignment idref="hypermutantAlignment8"/>
  <siteModel idref="siteModel9"/>
  <tkf91Model idref="tkf91Model2"/>
</tkf91Likelihood>


<tkf91Model> element

The TKF91 (Thorne, Kishino & Felsenstein 1991) model of insertion-deletion.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <lengthDistribution> containing:
  • Element named <deathRate> containing:


Example:

<tkf91Model units="substitutions">
 <lengthDistribution>
   <matrixParameter idref="matrixParameter4"/>
 </lengthDistribution>
 <deathRate>
   <compoundParameter idref="compoundParameter7"/>
 </deathRate>
</tkf91Model>


<tmrcaStatistic> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging
  • Attribute (optional) rate is Boolean


The element has the following contents:

  • Tree element (exactly one)
  • Element named <mrca> containing:
    • Taxa element (exactly one)
  • At least one of:**Attribute (optional) forParent is Boolean
    • Attribute (optional) includeStem is Boolean


Example:

<tmrcaStatistic name="foo" rate="true" forParent="true">
  <upgmaTree idref="upgmaTree3"/>
 <mrca>
   <taxa idref="taxa4"/>
 </mrca>
</tmrcaStatistic>


<TN93Model> element

This element represents an instance of the TN93 (Tamura and Nei 1993) model of nucleotide evolution.


The element has the following contents:

  • Element named <frequencies> containing:
  • Element named <kappa1> containing:
  • Element named <kappa2> containing:


Example:

<TN93Model>
 <frequencies>
   <frequencyModel idref="frequencyModel10"/>
 </frequencies>
 <kappa1>
   <diagonalMatrix idref="diagonalMatrix6"/>
 </kappa1>
 <kappa2>
   <maskedParameter idref="maskedParameter8"/>
 </kappa2>
</TN93Model>


<argPartitionOperator> element

An operator that picks a new partitioning uniformly at random.


The element takes following attributes:

  • Attribute weight is Integer
  • Attribute (optional) tossSize is Integer
  • Attribute (optional) tossAll is Boolean


The element has the following contents:


Example:

<argPartitionOperator weight="1" tossSize="1" tossAll="true">
  <argTreeModel idref="argTreeModel2"/>
</argPartitionOperator>


<traceAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.


The element takes following attributes:

  • Attribute fileName is String
    The name of a BEAST log file (can not include trees, which should be logged separately
  • Attribute (optional) burnIn is Integer
  • Attribute (optional) stdError is Boolean
  • Attribute (optional) computeMSE is Boolean


The element has the following contents:

  • Element named <expectation> containing:


Example:

<traceAnalysis fileName="foo" burnIn="1" stdError="true" computeMSE="true">
 <expectation name="foo" value="foo"/>
 <expectation name="foo" value="foo"/>
 <expectation name="foo" value="foo"/>
</traceAnalysis>


<traitGibbsOperator> element

This element returns a multivariate Gibbs operator on traits for possible all nodes.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) onlyInternalNodes is Boolean
  • Attribute (optional) onlyTipsWithPriors is Boolean


The element has the following contents:


Example:

<traitGibbsOperator weight="1.0" onlyInternalNodes="true" onlyTipsWithPriors="true">
  ERROR!
  <multivariateNormalPrior idref="multivariateNormalPrior2"/>
</traitGibbsOperator>


<traitRateGibbsOperator> element

This element returns a multivariate Gibbs operator on traits for possible all nodes.


The element takes following attributes:


The element has the following contents:


Example:

<traitRateGibbsOperator weight="1.0">
  <inhibitionLikelihood idref="inhibitionLikelihood3"/>
  <arbitraryBranchRates idref="arbitraryBranchRates9"/>
  <modelSpecificPseudoPrior idref="modelSpecificPseudoPrior1"/>
</traitRateGibbsOperator>


<tree> element

This element represents a rooted binary tree and associated attributes.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:


Example:

<tree units="substitutions">
  <node idref="node9"/>
</tree>


<treeBitMoveOperator> element

This element returns a bit-move operator on a given parameter.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) indicatorTrait is String
  • Attribute (optional) trait2 is String


The element has the following contents:


Example:

<treeBitMoveOperator weight="1.0" indicatorTrait="foo" trait2="foo">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1"/>
</treeBitMoveOperator>


<treeBitRandomWalk> element

This element returns a bit-random walk operator on a random indicator/variable pair in the tree.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) indicatorTrait is String
  • Attribute (optional) trait2 is String
  • Attribute (optional) swapTrait2 is Boolean
  • Attribute (optional) k is Integer


The element has the following contents:


Example:

<treeBitRandomWalk weight="1.0" indicatorTrait="foo" trait2="foo" swapTrait2="true" k="1">
  <treeModel idref="treeModel1"/>
</treeBitRandomWalk>


<diffusionRateStatistic> element

A statistic that returns the average of the branch rates


The element takes following attributes:

  • Attribute (optional) name is String
  • Attribute (optional) greatCircleDistance is Boolean


The element has the following contents:


Example:

<diffusionRateStatistic name="foo" greatCircleDistance="true">
  <inhibitionLikelihood idref="inhibitionLikelihood7"/>
  <multivariateTraitLikelihood idref="multivariateTraitLikelihood6"/>
  <multivariateTraitLikelihood idref="multivariateTraitLikelihood7"/>
</diffusionRateStatistic>


<treeLengthStatistic> element

A statistic that returns the average of the branch rates


The element takes following attributes:

  • Attribute (optional) name is String


The element has the following contents:


Example:

<treeLengthStatistic name="foo">
  <treeModel idref="treeModel8"/>
</treeLengthStatistic>


<treeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.


The element takes following attributes:

  • Attribute (optional) useAmbiguities is Boolean
  • Attribute (optional) allowMissingTaxa is Boolean
  • Attribute (optional) storePartials is Boolean
  • Attribute (optional) forceJavaCore is Boolean
  • Attribute (optional) forceRescaling is Boolean


The element has the following contents:


Example:

<treeLikelihood useAmbiguities="true" allowMissingTaxa="true" storePartials="true" forceJavaCore="true" forceRescaling="true">
  <mergePatterns idref="mergePatterns2"/>
  <treeModel idref="treeModel2"/>
  <siteModel idref="siteModel8"/>
</treeLikelihood>


<treeMetricStatistic> element

A statistic that returns the distance between two trees. with method="topology", return a 0 for identity and a 1 for difference. With other methods return the distance metric associated with that method.


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging
  • Attribute (optional) method is String
    comparision method (TOPOLOGY,BILLERA,ROBINSONSFOULD,CLADEHEIGHTM,BRANCHSCORE,CLADEMETRIC)


The element has the following contents:

  • Element named <target> containing:
    • Tree element (exactly one)
  • Element named <reference> containing:
    • Tree element (exactly one)


Example:

<treeMetricStatistic name="foo" method="foo">
 <target>
   <newick idref="newick8"/>
 </target>
 <reference>
   <argTreeModel idref="argTreeModel8"/>
 </reference>
</treeMetricStatistic>


<treeModel> element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.


The element has the following contents:

  • Tree element (exactly one)
  • Element named <rootHeight> containing:
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)
  • Element named <nodeHeights> containing:
    • Attribute (optional) rootNode is Boolean
      If true the root height is included in the parameter
    • Attribute (optional) internalNodes is Boolean
      If true the internal node heights (minus the root) are included in the parameter
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)
  • Element named <leafHeight> containing:
    • Attribute taxon is String
      The name of the taxon for the leaf
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)
  • Element named <nodeTraits> containing:
    • Attribute name is String
      The name of the trait attribute in the taxa
    • Attribute (optional) rootNode is Boolean
      If true the root trait is included in the parameter
    • Attribute (optional) internalNodes is Boolean
      If true the internal node traits (minus the root) are included in the parameter
    • Attribute (optional) leafNodes is Boolean
      If true the leaf node traits are included in the parameter
    • Attribute (optional) traitDimension is Integer
      The number of dimensions (if multivariate)
    • Attribute (optional) initialValue is Double
      The initial value(s)
    • Attribute (optional) fireTreeEvents is Boolean
      Whether to fire tree events if the traits change
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)
  • Element named <nodeRates> containing:
    • Attribute (optional) rootNode is Boolean
      If true the root rate is included in the parameter
    • Attribute (optional) internalNodes is Boolean
      If true the internal node rate (minus the root) are included in the parameter
    • Attribute (optional) leafNodes is Boolean
      If true the leaf node rate are included in the parameter
    • Attribute (optional) initialValue is Double
      The initial value(s)
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)
  • Element named <leafTrait> containing:
    • Attribute taxon is String
      The name of the taxon for the leaf
    • Attribute name is String
      The name of the trait attribute in the taxa
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)


Example:

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>


<treeShapeStatistics> element

A statistic that reports a handful of tree shape statistics on the given target tree.


The element takes following attributes:

  • Attribute (optional) name is String
    A name for this statistic primarily for the purposes of logging


The element has the following contents:

  • Element named <target> containing:


Example:

<treeShapeStatistics name="foo">
 <target>
   <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel7"/>
 </target>
</treeShapeStatistics>


<treeTraceAnalysis> element

Analyses and reports on a trace consisting of trees.


The element takes following attributes:

  • Attribute fileName is String
    name of a tree log file
  • Attribute (optional) burnIn is Integer
  • Attribute (optional) minCladeProbability is Double
  • Attribute (optional) credSetProbability is Double
  • Attribute (optional) shortReport is Boolean
  • Attribute (optional) referenceTree is String


Example:

<treeTraceAnalysis fileName="trees.log" burnIn="1" minCladeProbability="1.0" credSetProbability="1.0" shortReport="true" referenceTree="foo"/>


<treeUniform> element

Simultanouesly change height of two nodes.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) count is Integer


The element has the following contents:


Example:

<treeUniform weight="1.0" count="1">
  <treeModel idref="treeModel5"/>
</treeUniform>


<twoEpoch> element

A demographic model of two epochs.


The element takes following attributes:

  • Attribute units is String
    the units


The element has the following contents:

  • Element named <modernEpoch> containing:
    • DemographicModel element (exactly one)
      The demographic model for the recent epoch.
  • Element named <ancientEpoch> containing:
    • DemographicModel element (exactly one)
      The demographic model for the ancient epoch.
  • Element named <transitionTime> containing:
    • Parameter element (exactly one)
      The time that splits the two epochs.


Example:

<twoEpoch units="substitutions">
 <modernEpoch>
   <constantExponential idref="constantExponential3"/>
 </modernEpoch>
 <ancientEpoch>
   <constantExponential idref="constantExponential6"/>
 </ancientEpoch>
 <transitionTime>
   <designMatrix idref="designMatrix5"/>
 </transitionTime>
</twoEpoch>


<twoPartDistribution> element

Calculates the likelihood of some data given some parametric or empirical distribution.


Example:

<twoPartDistribution/>


<TWOPHASEModel> element

This element represents an instance of the Two Phase Model of microsatellite evolution.


The element takes following attributes:

  • Attribute (optional) estimateSubmodelParameters is String
    whether or not to esitmate the parameters of the submodel


The element has the following contents:

  • Microsatellite element (exactly one)
  • Element named <frequencies> containing:
  • Element named <Submodel> containing:
  • Element named <OnePhasePrParam> containing:
  • Element named <GeoParam> containing:
  • Element named <TransformParam> containing:


Example:

<TWOPHASEModel estimateSubmodelParameters="foo">
  <microsatellite idref="microsatellite8"/>
 <Submodel>
   <LINEARBIASModel idref="LINEARBIASModel7"/>
 </Submodel>
 <OnePhasePrParam>
   <matrixParameter idref="matrixParameter6"/>
 </OnePhasePrParam>
 <GeoParam>
   <maskedParameter idref="maskedParameter5"/>
 </GeoParam>
</TWOPHASEModel>


<UCLikelihood> element

This element returns an object that can calculate the likelihood of rates in a tree under the assumption of (log)normally distributed rates.


The element takes following attributes:

  • Attribute (optional) logspace is Boolean
    true if model considers the log of the rates.


The element has the following contents:

  • TreeModel element (exactly one)
  • Element named <rates> containing:
    • Parameter element (exactly one)
      The branch rates parameter
  • Element named <rootRate> containing:
    • Parameter element (exactly one)
      The root rate parameter
  • Element named <variance> containing:
    • Parameter element (exactly one)
      The standard deviation of the (log)normal distribution


Example:

<UCLikelihood logspace="true">
  <treeModel idref="treeModel1"/>
 <rates>
   <matrixParameter idref="matrixParameter3"/>
 </rates>
 <rootRate>
   <diagonalMatrix idref="diagonalMatrix2"/>
 </rootRate>
 <variance>
   <compoundSymmetricMatrix idref="compoundSymmetricMatrix5"/>
 </variance>
</UCLikelihood>


<uniformDistributionModel> element

Describes a uniform distribution with a given lower and upper bounds


The element has the following contents:

  • Element named <lower> containing:
  • Element named <upper> containing:


Example:

<uniformDistributionModel>
 <lower>
   1.0
 </lower>
 <upper>
   1.0
 </upper>
</uniformDistributionModel>


<uniformIntegerOperator> element

An operator that picks new parameter values uniformly at random.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) upper is Double
  • Attribute (optional) lower is Double
  • Attribute (optional) count is Double


The element has the following contents:


Example:

<uniformIntegerOperator weight="1.0" upper="1.0" lower="1.0" count="1.0">
  <duplicatedParameter idref="duplicatedParameter8"/>
</uniformIntegerOperator>


<uniformNodeHeightPrior> element

This element represents the likelihood of the tree given the demographic function.


The element takes following attributes:

  • Attribute (optional) analytic is Boolean
  • Attribute (optional) maxRootHeight is Double
  • Attribute (optional) mcSampleSize is Integer
  • Attribute (optional) marginal is Boolean
  • Attribute (optional) approximate is Boolean


The element has the following contents:


Example:

<uniformNodeHeightPrior analytic="true" maxRootHeight="1.0" mcSampleSize="1" marginal="true" approximate="true">
  <treeModel idref="treeModel9"/>
</uniformNodeHeightPrior>


<uniformOperator> element

An operator that picks new parameter values uniformly at random.


The element takes following attributes:

  • Attribute weight is Double
  • Attribute (optional) lower is Double
  • Attribute (optional) upper is Double


The element has the following contents:


Example:

<uniformOperator weight="1.0" lower="1.0" upper="1.0">
  <duplicatedParameter idref="duplicatedParameter8"/>
</uniformOperator>


<uniformPartitionLikelihood> element

null


The element has the following contents:


Example:

<uniformPartitionLikelihood>
  <argTreeModel idref="argTreeModel8"/>
</uniformPartitionLikelihood>


<uniformPrior> element

Calculates the prior probability of some data under a given uniform distribution.


The element takes following attributes:


The element has the following contents:


Example:

<uniformPrior lower="1.0" upper="1.0">
  <speciesTreeStatistic idref="speciesTreeStatistic3"/>
  <logarithmStatistic idref="logarithmStatistic4"/>
</uniformPrior>


<uniformNodeHeightPrior> element

This element represents the likelihood of the tree given the demographic function.


The element takes following attributes:

  • Attribute (optional) analytic is Boolean
  • Attribute (optional) maxRootHeight is Double
  • Attribute (optional) mcSampleSize is Integer
  • Attribute (optional) marginal is Boolean
  • Attribute (optional) approximate is Boolean


The element has the following contents:


Example:

<uniformNodeHeightPrior analytic="true" maxRootHeight="1.0" mcSampleSize="1" marginal="true" approximate="true">
  <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel10"/>
</uniformNodeHeightPrior>


<upDownOperator> element

This element represents an operator that scales two parameters in different directions. Each operation involves selecting a scale uniformly at random between scaleFactor and 1/scaleFactor. The up parameter is multipled by this scale and the down parameter is divided by this scale.


The element takes following attributes:

  • Attribute scaleFactor is Double
  • Attribute weight is Double
  • Attribute (optional) autoOptimize is Boolean


The element has the following contents:

  • Element named <up> containing:
    • Scalable element (zero or one)
    • Parameter element (zero or one)
    • Element named <scale> containing:
  • Element named <down> containing:
    • Scalable element (zero or one)
    • Parameter element (zero or one)
    • Element named <scale> containing:


Example:

<upDownOperator scaleFactor="1.0" weight="1.0" autoOptimize="true">
 <up/>
 <up/>
 <down/>
 <down/>
</upDownOperator>


<upgmaTree> element

This element returns a UPGMA tree generated from the given distances.


The element takes following attributes:

  • Attribute (optional) usingDates is Boolean
  • Attribute (optional) rootHeight is Double


The element has the following contents:


Example:

<upgmaTree usingDates="true" rootHeight="1.0">
  <distanceMatrix idref="distanceMatrix9"/>
</upgmaTree>


<variableDemographic> element

This element represents the likelihood of the tree given the population size vector.


The element takes following attributes:

  • Attribute (optional) type is String
  • Attribute (optional) logUnits is Boolean
  • Attribute (optional) useMidpoints is Boolean


The element has the following contents:

  • Element named <populationSizes> containing:
  • Element named <indicators> containing:
  • Element named <trees> containing:
    • Element named <ptree> containing:


Example:

<variableDemographic type="foo" logUnits="true" useMidpoints="true">
 <populationSizes>
   <designMatrix idref="designMatrix4"/>
 </populationSizes>
 <indicators>
   <diagonalMatrix idref="diagonalMatrix4"/>
 </indicators>
 <trees>
  <ptree ploidy="1.0">
    <treeModel idref="treeModel10"/>
  </ptree>
  <ptree ploidy="1.0">
    <treeModel idref="treeModel2"/>
  </ptree>
  <ptree ploidy="1.0">
    <treeModel idref="treeModel8"/>
  </ptree>
 </trees>
</variableDemographic>


<varianceStatistic> element

This element returns a statistic that is the variance of the child statistics.


The element has the following contents:


Example:

<varianceStatistic>
  <gmrfPopSizeStatistic idref="gmrfPopSizeStatistic7"/>
  <gmrfPopSizeStatistic idref="gmrfPopSizeStatistic9"/>
  <externalLengthStatistic idref="externalLengthStatistic9"/>
</varianceStatistic>


<VDAnalysis> element

reconstruct population graph from EBSP run.


The element takes following attributes:

  • Attribute (optional) burnIn is Double
    The number of states (not sampled states, but actual states) that are discarded from the beginning of the trace and are excluded from the analysis
  • Attribute (optional) Confidencelevels is Double;
  • Attribute (optional) useQuantiles is Boolean
  • Attribute (optional) logUnits is Boolean
  • Attribute (optional) useMidpoints is Boolean
  • Attribute (optional) nBins is Integer
  • Attribute (optional) nChanges is Integer


The element has the following contents:

  • Element named <logFileName> containing:
    • String element (exactly one)
      The name of a BEAST log file
  • Element named <treeFileNames> containing:
    • Element named <treeOfLoci> containing:
      • String element (exactly one)
        The name of a BEAST trees log file
  • Element named <populationModelType> containing:
    • String element (exactly one)
      population model type (stepwise, linear ...
  • Element named <populationFirstColumn> containing:
    • String element (exactly one)
      Name of first column of population size
  • Element named <indicatorsFirstColumn> containing:
    • String element (exactly one)
      Name of first column of population indicators
  • Element named <rootheightColumn> containing:
    • String element (exactly one)
      Name of trace column of root height
  • Element named <allDemographicsFileName> containing:
    • String element (exactly one)
      Name of file to output all demographic functions


Example:

<VDAnalysis burnIn="1.0" Confidencelevels="0.5 1.0" useQuantiles="true" logUnits="true" useMidpoints="true" nBins="1" nChanges="1">
 <logFileName>
   foo
 </logFileName>
 <treeFileNames>
  <treeOfLoci>
    foo
  </treeOfLoci>
  <treeOfLoci>
    foo
  </treeOfLoci>
 </treeFileNames>
 <populationModelType>
   foo
 </populationModelType>
 <populationFirstColumn>
   foo
 </populationFirstColumn>
 <indicatorsFirstColumn>
   foo
 </indicatorsFirstColumn>
</VDAnalysis>


<wideExchange> element

This element represents a wide exchange operator. This operator swaps two random subtrees.


The element takes following attributes:


The element has the following contents:


Example:

<wideExchange weight="1.0">
  <treeModel idref="treeModel10"/>
</wideExchange>


<wilsonBalding> element

An operator which performs the Wilson-Balding move on a tree


The element takes following attributes:


The element has the following contents:


Example:

<wilsonBalding weight="1.0">
  <treeModel idref="treeModel2"/>
</wilsonBalding>


<yangCodonModel> element

This element represents the Yang model of codon evolution.


The element takes following attributes:

  • Attribute (optional) geneticCode is String
    The genetic code to use


The element has the following contents:

  • Element named <omega> containing:
  • Element named <kappa> containing:
  • FrequencyModel element (exactly one)


Example:

<yangCodonModel geneticCode="flatwormMitochondrial">
 <omega>
   <parameter idref="parameter9"/>
 </omega>
 <kappa>
   <designMatrix idref="designMatrix7"/>
 </kappa>
  <frequencyModel idref="frequencyModel7"/>
</yangCodonModel>


<yuleModel> element

A speciation model of a simple constant rate Birth-death process.


The element takes following attributes:

  • Attribute (optional) conditionalOnRoot is Boolean
  • Attribute units is String
    the units


The element has the following contents:

  • Element named <birthRate> containing:


Example:

<yuleModel conditionalOnRoot="true" units="substitutions">
 <birthRate>
   <designMatrix idref="designMatrix7"/>
 </birthRate>
</yuleModel>


BEAST types

The following is a list of generic types that elements represent in a beast file.

ARGModel

Elements of this type include:

ARGPartitionLikelihood

Elements of this type include:

ARGRatePrior

Elements of this type include:

AbstractDistributionLikelihood

Elements of this type include:

AbstractMultivariateTraitLikelihood

Elements of this type include:

AbstractSubstitutionModel

Elements of this type include:

Alignment

Elements of this type include:

ArbitraryBranchRates

Elements of this type include:

Attribute

Elements of this type include:

Attribute$Default

Elements of this type include:


BayesianSkylineLikelihood

Elements of this type include:

BayesianStochasticSearchVariableSelection

Elements of this type include:


Boolean

Elements of this type include:


BooleanStatistic

Elements of this type include:

BranchRateModel

Elements of this type include:

BranchRates

Elements of this type include:

BranchingModel

Elements of this type include:

ColourSamplerModel

Elements of this type include:


Columns

Elements of this type include:

CompoundParameter

Elements of this type include:

DataType

Elements of this type include:

Date

Elements of this type include:

DemographicModel

Elements of this type include:

DesignMatrix

Elements of this type include:

DistanceMatrix

Elements of this type include:

Distribution

Elements of this type include:

DistributionLikelihood

Elements of this type include:

Double

Elements of this type include:

Double;

Elements of this type include:


EmpiricalTreeDistributionModel

Elements of this type include:

FrequencyModel

Elements of this type include:

GMRFSkyrideLikelihood

Elements of this type include:

GammaSiteModel

Elements of this type include:

GeneralizedLinearModel

Elements of this type include:

GeoSpatialCollectionModel

Elements of this type include:


HypermutantAlignment

Elements of this type include:


Identifiable

Elements of this type include:

Integer

Elements of this type include:

Integer;

Elements of this type include:


IntegratedMultivariateTraitLikelihood

Elements of this type include:


KMLCoordinates

Elements of this type include:

Likelihood

Elements of this type include:

LinearRegression

Elements of this type include:


Location

Elements of this type include:

Loggable

Elements of this type include:

Logger

Elements of this type include:

MCMCOperator

Elements of this type include:

MapDiffusionModel

Elements of this type include:


MatrixParameter

Elements of this type include:

Microsatellite

Elements of this type include:

MicrosatelliteModel

Elements of this type include:

MicrosatelliteSamplerTreeModel

Elements of this type include:

Model

Elements of this type include:

MultivariateDiffusionModel

Elements of this type include:

MultivariateDistributionLikelihood

Elements of this type include:

MutationDeathType

Elements of this type include:

NodePosteriorTreeLikelihood

Elements of this type include:


OldAbstractCoalescentLikelihood

Elements of this type include:

OnePhaseModel

Elements of this type include:

OperatorSchedule

Elements of this type include:

Parameter

Elements of this type include:

ParametricDistributionModel

Elements of this type include:

PatternList

Elements of this type include:

Patterns

Elements of this type include:

Polygon2D

Elements of this type include:

RandomLocalTreeVariable

Elements of this type include:

RateEvolutionLikelihood

Elements of this type include:

SampledMultivariateTraitLikelihood

Elements of this type include:


Scalable

Elements of this type include:

Sequence

Elements of this type include:

SimpleMCMCOperator

Elements of this type include:

SimpleNode

Elements of this type include:

SiteList

Elements of this type include:

SiteModel

Elements of this type include:

SitePatterns

Elements of this type include:


SpeciationModel

Elements of this type include:

SpeciesBindings

Elements of this type include:

SpeciesBindings$SPinfo

Elements of this type include:

SpeciesTreeModel

Elements of this type include:

Statistic

Elements of this type include:

StatisticList

Elements of this type include:

String

Elements of this type include:

String;

Elements of this type include:


SubstitutionModel

Elements of this type include:

TKF91Likelihood

Elements of this type include:

TKF91Model

Elements of this type include:

TabularData

Elements of this type include:

Taxa

Elements of this type include:

Taxon

Elements of this type include:

TaxonList

Elements of this type include:

TipPartialsModel

Elements of this type include:

Tree

Elements of this type include:

TreeAttributeProvider

Elements of this type include:

TreeColouringProvider

Elements of this type include:


TreeLikelihood

Elements of this type include:

TreeLogger$LogUpon

Elements of this type include:

TreeModel

Elements of this type include:

TreeTraitProvider

Elements of this type include:

ValuesPool

Elements of this type include:


Variable

Elements of this type include:

VariableDemographicModel

Elements of this type include:

Personal tools